You are here

The key to sustainable sea lice control is in the genome.

A F3 (IRP2)

Christiane Trösse's picture
General
End Date: 
Friday, February 24, 2012 - 09:00
Experiment Batch ID: 
A
Start Date: 
Monday, January 23, 2012 - 09:00
Experiment Contact: 
Sample
Developmental Stage CV: 
PreAdult2
Adult
Sex: 
female
Number of Individuals (Start): 
39
Target description
Gene or target symbol: 
LsIRP1B
Fragment description
Fragment Producer Contact: 
Fragment Label ID: 
F3
Fragment concentration: 
600.00ng/ul
Fragment length: 
441bp
Sense sequence: 
ggtgtgagtccgagtccacagcgattccaattaaattaatgaaagaagggccctcatcagggactatggaagatgaagaccttctcaaggatttccaagttggggaaagaagctacaaatattacgacgtaacccaaatccagggctatgaggaactcccttactccttgcgtgttctcctggagtgtgccgttcgaaagcgttcggaaacgcaaggacaagtctggaaggatgtttatgaacggattttgaggcgagttcttcttcaggatttcacaggagttccagcattgatcgatttagcagcgatccgtgaatctgtatccaagtccggtggttgtccggatgtggtggacagtctttgtccagcagatctggttgtagatcactgtgttcaagtggactacaaccaaatcaagcagcaactgtcaagtccgcctg
Fragment Producer: 
licelab
Primer Group: 
b640
Validation
Efficacy of Knock Down: 
F>45.00%
Phenotype
Number of Individuals (End): 
23
Gallery Image: 
Image file: 
Upload
Image Quality: 
0
No votes yet

Knockdown of LsIRP1B (formerly called IRP2) in preadult female lice. Slightly shorter egg strings caused less offspring.