A F3 (IRP2)

General

End Date: 

Friday, February 24, 2012 - 09:00

Experiment Batch ID: 

A

Start Date: 

Monday, January 23, 2012 - 09:00

Experiment Contact: 

Publication: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

39

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

LsIRP1B

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F3

Fragment concentration: 

600.00ng/ul

Fragment length: 

441bp

Sense sequence: 

ggtgtgagtccgagtccacagcgattccaattaaattaatgaaagaagggccctcatcagggactatggaagatgaagaccttctcaaggatttccaagttggggaaagaagctacaaatattacgacgtaacccaaatccagggctatgaggaactcccttactccttgcgtgttctcctggagtgtgccgttcgaaagcgttcggaaacgcaaggacaagtctggaaggatgtttatgaacggattttgaggcgagttcttcttcaggatttcacaggagttccagcattgatcgatttagcagcgatccgtgaatctgtatccaagtccggtggttgtccggatgtggtggacagtctttgtccagcagatctggttgtagatcactgtgttcaagtggactacaaccaaatcaagcagcaactgtcaagtccgcctg

Fragment Producer: 

licelab

Primer Group: 

b640
Validation

Efficacy of Knock Down: 

F>45.00%
Phenotype

Phenotype CV: 

Number of Individuals (End): 

23

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Knockdown of LsIRP1B (formerly called IRP2) in preadult female lice. Slightly shorter egg strings caused less offspring.