You are here

The key to sustainable sea lice control is in the genome.

B F2+F3 (IRP1+IRP2)

Christiane Trösse's picture
General
End Date: 
Wednesday, April 18, 2012 - 09:00
Experiment Batch ID: 
B
Start Date: 
Monday, March 19, 2012 - 09:00
Experiment Contact: 
Sample
Developmental Stage CV: 
PreAdult2
Adult
Sex: 
female
Number of Individuals (Start): 
39
Target description
Fragment description
Fragment Producer Contact: 
Fragment Label ID: 
F3
F2
Fragment concentration: 
600.00ng/ul
Fragment length: 
441bp
Sense sequence: 
ggtgtgagtccgagtccacagcgattccaattaaattaatgaaagaagggccctcatcagggactatggaagatgaagaccttctcaaggatttccaagttggggaaagaagctacaaatattacgacgtaacccaaatccagggctatgaggaactcccttactccttgcgtgttctcctggagtgtgccgttcgaaagcgttcggaaacgcaaggacaagtctggaaggatgtttatgaacggattttgaggcgagttcttcttcaggatttcacaggagttccagcattgatcgatttagcagcgatccgtgaatctgtatccaagtccggtggttgtccggatgtggtggacagtctttgtccagcagatctggttgtagatcactgtgttcaagtggactacaaccaaatcaagcagcaactgtcaagtccgcctg
Fragment Mixture Formula: 
1:1 mixture, resulting in 300 ng/ul for each of the fragments
Fragment Producer: 
licelab
Primer Group: 
b640
Validation
Efficacy of Knock Down: 
F>44.00%
Phenotype
Number of Individuals (End): 
23
Gallery Image: 
Image file: 
Upload
Image Quality: 
0
No votes yet

Knockdown of LsIRP1A+LsIRP1B (formerly called IRP1 and IRP2) in preadult female lice. Slightly shorter egg strings. Knockdown 62% for IRP1 and 44% for IRP2. Described in the fragment fields is only F3, see experiment A for F2.