B F2+F3 (IRP1+IRP2)

General

End Date: 

Wednesday, April 18, 2012 - 09:00

Experiment Batch ID: 

B

Start Date: 

Monday, March 19, 2012 - 09:00

Experiment Contact: 

Publication: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

39

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F3
F2

Fragment concentration: 

600.00ng/ul

Fragment length: 

441bp

Sense sequence: 

ggtgtgagtccgagtccacagcgattccaattaaattaatgaaagaagggccctcatcagggactatggaagatgaagaccttctcaaggatttccaagttggggaaagaagctacaaatattacgacgtaacccaaatccagggctatgaggaactcccttactccttgcgtgttctcctggagtgtgccgttcgaaagcgttcggaaacgcaaggacaagtctggaaggatgtttatgaacggattttgaggcgagttcttcttcaggatttcacaggagttccagcattgatcgatttagcagcgatccgtgaatctgtatccaagtccggtggttgtccggatgtggtggacagtctttgtccagcagatctggttgtagatcactgtgttcaagtggactacaaccaaatcaagcagcaactgtcaagtccgcctg

Fragment Mixture Formula: 

1:1 mixture, resulting in 300 ng/ul for each of the fragments

Fragment Producer: 

licelab

Primer Group: 

b640
Validation

Efficacy of Knock Down: 

F>44.00%
Phenotype

Phenotype CV: 

Number of Individuals (End): 

23

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Knockdown of LsIRP1A+LsIRP1B (formerly called IRP1 and IRP2) in preadult female lice. Slightly shorter egg strings. Knockdown 62% for IRP1 and 44% for IRP2. Described in the fragment fields is only F3, see experiment A for F2.