C F4 (CopB2)

General

End Date: 

Monday, September 24, 2012 - 09:00

Experiment Batch ID: 

C

Start Date: 

Tuesday, August 14, 2012 - 09:00

Experiment Contact: 

Publication: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

39

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

LsCopB2

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F4

Fragment concentration: 

600.00ng/ul

Fragment length: 

566bp

Sense sequence: 

atcgtgtcaagtccacagacctgcacccagtggagccttggatgttggcctcgctctacaacgggaacgtgcacatttggaactacgagtctcagcagttggtcaagtccctggaggtgtgcgacttgccggtgcgagccgccaagtttgtgagccgtaagaattgggtggtgacgggttctgacgacatgaagctgaatgtgttcaactacaacaccctggagcgtgtgtcttgcctggaggcgcactctgactatctgcggtccctggccgtccacccgagtgagcccctggtcctctcctcctcggacgacatgctcattaagctctggaactgggacaaggcctgggcctgtgaacaggtcttcgagggacacacgcactacataatgcaagtggtcatcaaccccaaggacaacaacacttttgcctccgcctctttggaccgcaccatcaaggtctggcacttgggcgcatcttgccccaacttcactctggagggacatgacaagggcgtcaactgtctggactactaccacgccggggacaagccctacctcatctcg

Fragment Producer: 

licelab

Primer Group: 

b671
Validation

Efficacy of Knock Down: 

F>82.00%
Phenotype

Phenotype CV: 

Number of Individuals (End): 

0

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Knockdown of LsCopB2 in preadult female lice. Early termination after 15 days (Rack 4a and 4b - no survivors in 4c at normal termination date). High mortality, empty gut, no egg strings, underdeveloped genital segment and abdomen.