You are here

The key to sustainable sea lice control is in the genome.

C F4 (CopB2)

Christiane Trösse's picture
General
End Date: 
Monday, September 24, 2012 - 09:00
Experiment Batch ID: 
C
Start Date: 
Tuesday, August 14, 2012 - 09:00
Experiment Contact: 
Sample
Developmental Stage CV: 
PreAdult2
Adult
Sex: 
female
Number of Individuals (Start): 
39
Target description
Gene or target symbol: 
LsCopB2
Fragment description
Fragment Producer Contact: 
Fragment Label ID: 
F4
Fragment concentration: 
600.00ng/ul
Fragment length: 
566bp
Sense sequence: 
atcgtgtcaagtccacagacctgcacccagtggagccttggatgttggcctcgctctacaacgggaacgtgcacatttggaactacgagtctcagcagttggtcaagtccctggaggtgtgcgacttgccggtgcgagccgccaagtttgtgagccgtaagaattgggtggtgacgggttctgacgacatgaagctgaatgtgttcaactacaacaccctggagcgtgtgtcttgcctggaggcgcactctgactatctgcggtccctggccgtccacccgagtgagcccctggtcctctcctcctcggacgacatgctcattaagctctggaactgggacaaggcctgggcctgtgaacaggtcttcgagggacacacgcactacataatgcaagtggtcatcaaccccaaggacaacaacacttttgcctccgcctctttggaccgcaccatcaaggtctggcacttgggcgcatcttgccccaacttcactctggagggacatgacaagggcgtcaactgtctggactactaccacgccggggacaagccctacctcatctcg
Fragment Producer: 
licelab
Primer Group: 
b671
Validation
Efficacy of Knock Down: 
F>82.00%
Phenotype
Number of Individuals (End): 
0
Gallery Image: 
Image file: 
Upload
Image Quality: 
0
No votes yet

Knockdown of LsCopB2 in preadult female lice. Early termination after 15 days (Rack 4a and 4b - no survivors in 4c at normal termination date). High mortality, empty gut, no egg strings, underdeveloped genital segment and abdomen.