M-F114

General

End Date: 

Tuesday, July 2, 2013 (All day)

Experiment Batch ID: 

M

Start Date: 

Tuesday, May 14, 2013 - 09:00

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

40

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F114

Fragment concentration: 

600.00ng/ul

Fragment length: 

519bp

Sense sequence: 

GATTCTAGGCGTCTTTGCGATGGATACACAGATTGTTTGGACGGATCAGATGAAGTAGACTGTTTGAGTGTTGTATGCCAATATTGGCAGTTCAAATGTTTATTAGACGGAGTCTGTGTGACTCTCGTCGCAAATGTGATGGATATAATGACTGTAACGATGGCTCTGACGAGACTAATTGTAAGGACTAAGTACTCAAACATATATCTTTGAACATTCTCCAAAAACAATCCCAGTTAAACTTTTTTCAAATGATTTTGGACTGTAATGTTGTGAATCCATCTGGAAAATGGACATATGAAGGGCAGAACGTACATGATGTACTTCAGCGGGACTTGAGGGACGATTGGGAACTGCGTTTAAAAATGGAAGTCTTTTGATTCGAAATTTCCAAAAGGAGGACGTTGGATATTACACTTGTGCTTCTTCTGGAGGAAACGAAGTATCTTCAGTTTACGTAGTCTTAGATGCATCCTCATGTAAAAAGGAATGTAAGGACGATGAGTTTGCACAGCGTGT

Fragment Producer: 

licelab
Phenotype

Phenotype: 

No visible phenotype

Number of Individuals (End): 

13

Gallery Image: 

Upload

Image Quality: 

0
No votes yet

Similar to Vitellogenin receptor