|
Associated RNAi Experiments
Table of all RNA interference experiments conducted using this feature, grouped by Phenotype CV: no visible phenotype
Gallery Image |
Title |
Gene or target symbol |
Sex/Stage |
Phenotype |
Date |
|
Z F218 |
CTH210 |
female |
-Missing- no visible phenotype |
27.08.2015 - 13:44 01.10.2015 - 00:00 |
Properties
Property Name | Value |
Note | Negative control fragment Gadus morhua mRNA for immunoglobulin light chain, isotype 2 (igl2 gene), clone S1-41 (L-V-J-C) |
Sequences
The following sequences are available for this feature:
PCR_product sequence >CTH210 ID=CTH210|Name=CTH210 (negative control)|organism=Gadus morhua|type=PCR_product|length=482bp gtactgaaacggacagcagtggcaactatgtgttgtcctggttccagcag aagagtggttcaccgccaaagtttttacttaccacaacaagcagtagggc aagtggcgttcccagtaggtttacttattctggtacaagaaatgacaaaa cagagtatctactgattaatggcattcaagatgaagatgaggcgacatac tactgtgcgtgtgtcagctgtggtacagactctccaaccttctttggtgg tggcactgaagtcattcttgctggttccccgtccccccccagtctggagc tgatggtggccacccagcctcctgtcccggggctgggggggcccactctg gtgtgcctggctaagggcttccacccggccggggccgccctgtcctggtc cgaggacggagcctctgtgaggggcgaggaggtccgggggggcgtggccc agcggcagcctgatggaagctactcccttagc back to top
|