LsRhabNo127.M-protein.g, AIY25914.1.g (gene) Lepeophtheirus salmonis rhabdovirus No127

Overview
NameLsRhabNo127.M-protein.g
Unique NameAIY25914.1.g
Typegene
OrganismLepeophtheirus salmonis rhabdovirus No127 (Lepeophtheirus salmonis rhabdovirus No127)
Associated RNAi Experiments

Nothing found

Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
KJ958536viral_sequenceKJ958536:2709..3368 +
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GenBank2017-12-04 .396135
Properties
Property NameValue
Codon start1
NoteM-protein
Productmatrix protein
Protein idAIY25914.1
Translationlength.219
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LsRhabNo127.matrix-protein.tAIY25914.1.tLepeophtheirus salmonis rhabdovirus No127mRNA


Synonyms
The feature 'LsRhabNo127.M-protein.g' has the following synonyms
Synonym
M-protein
Sequences
The following sequences are available for this feature:

gene from alignment at KJ958536:2709..3368+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AIY25914.1.g ID=AIY25914.1.g|Name=LsRhabNo127.M-protein.g|organism=Lepeophtheirus salmonis rhabdovirus No127|type=gene|length=660bp|location=Sequence derived from alignment at KJ958536:2709..3368+ (Lepeophtheirus salmonis rhabdovirus No127)
ATGCTCAGAAAAGCAGCACTTGCACTCAGAGGGGGGAACAAGGAGGAGGA TAGACACCCCGTCACAAGTTGGTCCTCCCCGATTCAATCTCCCTCAGCAC CCATGGACTCGAGACTTCTCACAGTGAATTTAAAGGTTACAGCCCATATG TCTGTTCGAACAACGAACAAAAACATCGTTTTTAGTGATGTTCTATTGGC CTGCACGGATATTATGGACACATATGACGGACCAATGGAGACTCTTGGGT TTTACTGGATAATGATTTTAGTCCTCGTTAAGAGACTCAAATCATTGAGG GGAAACGAGGGAACACAAGATTTTGTATCATCGGTATCAGAGCCAATATC TTTCCTGACTGACATCAGTTCTCCTTATCTGAAAACATTCCCGACTACGG CTTTCTCTTTTGGGAGAGAGTTTCGAGCCGGGAAGGTCTCTGGTAATGCT TCAGTATCTTTCTCAGAAACTCGAGCTGTCACAACCTCCTTGGAACTTAT ATTGCAAAGTCTAGGACTGGTGAATGATCATCTGGGAAGTGCCCTGTCAG CGTTAAAAATTCCTGCAGAAAGGATTAAGGGATCGCTGGTAATACATATG GCCCTTAGAGATTCATTTTCTCATATCCAGCCTGCGACCCTGAAGGAGAC CTCTGATTAA
back to top
Add to Basket