LsRhabNo127.nucleoprotein.g, KJ958536.nucleoprotein.g (gene) Lepeophtheirus salmonis rhabdovirus No127

Overview
NameLsRhabNo127.nucleoprotein.g
Unique NameKJ958536.nucleoprotein.g
Typegene
OrganismLepeophtheirus salmonis rhabdovirus No127 (Lepeophtheirus salmonis rhabdovirus No127)
Associated RNAi Experiments
Table of all RNA interference experiments conducted using this feature, grouped by Phenotype CV: -Missing-
Gallery Image Title Gene or target symbol Sex/Stage Phenotype Datesort descending Publication
Rhabdovirus - No9+127 Specificity N protein LsRV-No9, N protein LsRV-No127 unknown
  1. Nauplius I
  2. Copepodid
-Missing-
-Missing-
19.04.2015 - 14:11
RNAi-mediated treatment of two vertically... more
Table of all RNA interference experiments conducted using this feature, grouped by Phenotype CV: no visible phenotype
Gallery Image Title Gene or target symbol Sex/Stage Phenotype Datesort descending Publication
Rhabdovirus - No9+127 prod of virus free strain N protein LsRV-No9, N protein LsRV-No127 unknown
  1. Nauplius I
  2. Adult
-Missing-
no visible phenotype
16.01.2017 - 14:11
RNAi-mediated treatment of two vertically... more
Rhabdovirus - No9+127 prod of virus free strain N protein LsRV-No9, N protein LsRV-No127 unknown
  1. Nauplius I
  2. Adult
-Missing-
no visible phenotype
16.01.2017 - 14:11
RNAi-mediated treatment of two vertically... more
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
KJ958536viral_sequenceKJ958536:141..1541 +
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GenBank2017-12-04 .396135
Properties
Property NameValue
NoteN-protein
Translationlength.466
Protein idAIY25912.1
Productnucleoprotein
Codon start1
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LsRhabNo127.nucleoproteinKJ958536.nucleoprotein.tLepeophtheirus salmonis rhabdovirus No127mRNA


Sequences
The following sequences are available for this feature:

gene from alignment at KJ958536:141..1541+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KJ958536.nucleoprotein.g ID=KJ958536.nucleoprotein.g|Name=LsRhabNo127.nucleoprotein.g|organism=Lepeophtheirus salmonis rhabdovirus No127|type=gene|length=1401bp|location=Sequence derived from alignment at KJ958536:141..1541+ (Lepeophtheirus salmonis rhabdovirus No127)
ATGGCTCTAACAAAACTCGTGCTAGTATCTGATCCGACAAAGAGTATAAC CATAGGGAAATCAATACTCGTAACACCAGCCAGTTTCCCGTCTCAATGGT TTGCAGATAACCCAGGAGAAAAACCAAGAGTGATCATAGACGTACCCAAA ACTCTCCAGGATGAAGATGTATCATCGGTTTTCTTTCAATACATCACCAC TAGGACTCCGGTACCAGTATGGGCTATCTGCAAATCCATCAAGTATCTAC TGGATCAGGACTTTATCACTCTTCCTGCAAAGGAGGAGTGGAAGAGTTTT GGAAGATTATTGGGCAGAGGAGGAACGCAGGTATTTTTAAATGACTTGTC CGATATAACCTGGAACCCCGTCGAGATCATAACCCCACCTGGAGAAAAGA ATAGGAGGACGGACGGGGAGTTATACCTGGCTTTGATTCTAGTTCTCATA TCGGTAAGGATAGATAGAGAACCTATTCGTGCTGGACAAGTTAGATTGAT GGAAAGATTTTCTTCACTCCCTAGTCCTTCCGGTACTACAGCCGCGGGGA TTCTTAGAGATAGTCATGTCTCTGTCACAGATGAACTCCGGTTTTTCTTG GCCATCACGGACATGTACCTTTTCCGGAAAGGACCAACAGCCAGATACTC CCTGTTGAGGCAGGGAACAATCATCACCAGGCATAGAGACCAAACCTTTC TCTCAGAGTTTGACCACATCTCAAACATAACAGCTATGGAGCCATCGGAG GTTATGACCTGGGTGACTCTTGATTCCGTCTCGACTGAGATCTTGAAGAC CGTCAGAGATACTGAGGAAATTTATTGTCCTTTCTCTTATGCCCCCTATA TGATGGATCTCGGGATATCAGCTAAGTCTCCGTATTCGGTCACAGAAAAT CCTTTGTCTCACCTATGGATTCATGTGACAGGAGTAATATTAAATAACCC GCGATCTATGAATGCCCGGATTATCGGGGAGACCACATTTCATCAGGTAA TTTTGTCCTCCGCCCTCCTGGCTTATCGGTGCGCAACAAGTCCTTTATTG AGTCAAAAGTTCAGTGGACAATCCGACCTCAGAGGGGTAGAAGAGAGTAT TAGGGTCTTGTCGGAGTCAAGTTCATATTTCTCAAACACTGAGGATCTTG ATCTGGAAGACGATCCACAACAAAACACTCCCATGGCATACGTCGCTTGG TGTGACAACAAGTGGAACCGTCGACTTTTTACATTTGTAGACTCCGCAAT GCTAGGATTGACACGGCCCCTTAGAGAGCGACAAATGGGGCATATTTTCC GAGATTTCTGGGCAGGATTTAGGAATCAGATAGCTGAAGATCTAAATGTT CCTCTCAAGAATTGGACTCGAACTGCTATTGAAGGAGCCGGCCGAATCTG A
back to top
Add to Basket