Drosophila hunchback

General

Date: 

1363302000
Sample

Strain: 

wild type

Organism: 

Developmental stage: 

Embryo
Target description

Target sequence: 

>gi|2151470|gb|AA439589.1|AA439589 LD14196.5prime LD Drosophila melanogaster embryo BlueScript Drosophila melanogaster cDNA clone LD14196 5prime similar to U17742: Drosophila melanogaster zinc finger DNA-binding protein (hb) gene, complete cds; Y00274: Drosophila melanogaster hunchback gene coding for a finger protein, mRNA sequence AAAGTCGCCAGCATTGACAGGCAGCCACTGAAATACAAAAATAACCAAACATCCAAAGGACGAAACGTAA CTGCTATCAAAACAAATATTGCCATTAAATACAATTAAACTTCGTGCTTGTGCTAAAAGATAACCAATTG CAAAAAGACTTTTGTCCCGAAAACTTATTTTTTGGCAAAGACCACATCCCGCACATGCGCGAATTCCGCG AAAAAGAAAGCACAAAAGCAAGCTAAAAAGCGAGGCCCAAAAAATAGACAAAAACGAAGAGCAAGGAGCC CCCACATCGCCGCTCCCCCTCGCACGCACTGTGCGTGTTGGTCTAACGGTAACCGTGCCGCGGTCAAGCG AGAGAGTGGGAAAGAGAGAGTCCGCGAGCGAAAAGCGAAAACTTACGTGCTCCTGCTCCTGCTCCCGGTT CCCGTTTCCAAATTCTCCCGCAGAATTGCACTTGGACTGTCCGCAAGCCGTCTAGAGCCGCCAAGATGCA GAACTGGGAGACGACAGCCACGACCAACTACGAGCAGCACAACGCCTGGTACAACAGCATGTTTCGCGGC AAATA

Target ID: 

Target name: 

Hunchback

Target type: 

RNA
Uploads

Imaging technology: 

immunohistochemistry

Gallery image: 

Image files: 

Dye: 

In situ hybridization of wild typeDrosophila embryos at different developmental stages for the RNA from a gene called hunchback.