Shadow (CYP315A1)

General

Date: 

1418252400
Sample

Strain: 

wild type

Tissue: 

Adult female ovaries, intestine, immature egg

Organism: 

Target description

Target sequence: 

ATGAGTCGCTTTTGTCGTCAAAGATTATACTCAACAATTCCTCGTGTCGGAGAATTTATTGAAAAAATTAAATCATCTTTTCTTCAAGATCCTGGTAAATATTTGCACGAAATAAACCGAACACGGCATGAAATACTGGGACCCATGTATTTAGAAAGAATAGGCCCTGACGTTGACGCGCTGTTCATTGCCGATCCAGAGATTGTTCGAAAAATATTTTCTTTGGAGTCAAAATATCCCAAACACTTTATTCCCCAGGCGTGGAGTGTATATGGCGATATGAGGAATAGAAAACGAGGTTTGTTTTTCTTAGATGGACCTGAATGGCTTCGAATGCGGCGGGKTCTTWATCCTATCCTTTTAAATAATGACTCTGTTCATAAATTTGTACCTTTTTTTGAGAAGGAAGCTCGAAGATTTCTTAATAATGTAGAGGCTAATAGCTCCCCTCCTCCATCAAACTCGTCTCAAAAATATGGTACATTTAAAAATCTCCCAATAGAATTACACCGTTGGTCAGTCCGGAGCATTTTAGCGGTCATTTTTGGAGATTCGAATATACTGTCAGAAGAAGAAGAGGAAGGTCTAATTGAAGATGTTCAGATCATTTTTGATATAAGTGCTCGTTTACAATTTACGTCTGCTTTGGAGTCTTGTCGACAAAATACTCCAGATTGGATARATTTTTCAAGTGCTGCGGATAGAGTTTTTGAATTACTTAATAAATCCATAAAGAATACAAATGTCAATTCAAAATCACTATCTGGAGTGTTAATATCCCAAGGAGTATCTTACGAGGATGTAGAAAGAATAGCAATGGATTTTGTCATCGCTGCTGTAGATACAACCTCAATAAGTACACTATGGATACTTCATCTCATCTCTCAAGATACTTACATTCAAAATGAAATTCGAATATCTTTCGATAATCAATTGCTTCGTAACTGCATGAGAGAAGCATCTAGACTGTATCCAGTTTCTCCCTTCATAACAAGAGTTCTGGATAAAGATATTTTAATTGAAGGATCAAAATTGCGGACTGGACAATTAATCCTATTCTCTATTTATACTATGAGTAGGAATCCAAATTATTTTACCAAGCCAGAACACTTTTTGCCACAAAGATGGGATATTACACCCTCATCATTTGCAAGTATTCCCTTTGGATTTAGAGCTAGAAGCTGCATTGGTAAAAAGTTAGCTGAACTTAGCATGGAAACTTTGATTAAAGGACTTATTCAGAGATATAAAATACATTGCTTAAACTACGAAAAAGCCGAAATGATTATGAAATTTATCGGACTACCTGATAGAACAATTAAAATAGGATTGGAACATATTGGTATTCCTCGCCCTACGTTTAACGTCGAACCCAAGAGTTTTTCGACCAAGAAAGAGAGATCCACTCCTTCATTTCGTCCTCCACCGAAGCCTCCCTCTAAGACTTGTCCTCCAGTTTCAAGAATCTTCTCCAATCGTCCTGACTTTTATCGAGCTCAATCCATAACTTTTCTGGCCTCTCCGGATGGGTCCCTCACGGGGACACCTTTGCTCTCAGMCAGCCACTACGACGAAAACAAAAAACTCTCTTACTTTGAACAAGCATTTGAAATCAAGGAAAAGATCGGAGCTGGCTTCTTTGGAACCGTCTACAAAGTTCGGAGTAAACAAGATGGACTCGAATATGCGGTGAAGATTGCGCAAGAGTCGTATCGTGGACGCTCGGACAGAGCTCGTAAATTGGAAGAAGTCCGGAAACATCAATTCCTTTTACCTCATTCTAATTGTGTTCATTTCTACCAGTCCTGGGAAGAAAAAGGCCGACTATATCAGCAGTTTGAACTATGTGAAAAAAGTCTTCAGGAATTTGCAGATGAGGATCATGATATMCCAGAGTCACAAATATGGGACTATCTTGTTGATCTTCTCCTAGCCGTCAAACATCTCCATGAGCATGATCTCATTCATATGGATATCAAACCTGAAAATATTTTCATAGGTCGTGATGGAATATGCAAATTAGGGGATTTTGGTATTGTCATCGATTTAGCTAAAAACGACTCTTCAAATCATGCAGTTGAAGGGGATCCTAAATATTTAGCCACAGAAGTCCTTGCTCGTAATTATTCCAAAGCTGCTGATATATTTAGCCTGGGTGTTACCATGCTGGAAGTTGCATGTGATCTTGATCTTCCTAAACAGGGGGC

Target ID: 

Target name: 

Shadow

Target type: 

RNA
Uploads

Imaging technology: 

immunohistochemistry

Gallery image: 

Image files: