D F32

General

End Date: 

Wednesday, October 3, 2012 (All day)

Experiment Batch ID: 

d

Start Date: 

Friday, August 24, 2012 - 13:42

Experiment Contact: 

Publication: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

40

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

NLG3408_TSC1

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F32

Fragment concentration: 

600.00ng/ul

Fragment length: 

549bp

Sense sequence: 

ctgctctgagagatcaactccagcttgtcaaatcagaaattgatgatttacaccgtcaaattgaggaaataagaagggaaaaacatctgatagaggaagaaaggtcatttactgcaagaaatagaggtcatgaaatcgaaaaaaggtctgctgagattagatctttaaaaatcagtgcacaaaaatctgaagaaataattgatgagctcaaccatgctgtagtagaaggaaggaaggagttggatacctccagggctcaatttttcctaatgaaagctgaatgcgaggttttacatcaaaaagaaagcgcaagaatgatgacggaattggaattggttcgactgagaaaggaacttgtcatgatgggtgagcttcagtcaaaatataaggagcggttggataatcctgctaacaacatggaatctgagaccatgaatctctttaagcaggcttatgaaagggatctacagactatggccagagctctggagaacaaaacatttgaagtagagacattcaagtgtcgtatcaccgagttggactccttgc
Validation

Efficacy of Knock Down: 

F>33.00%
Phenotype

Phenotype CV: 

Number of Individuals (End): 

7

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Downregulation of TSC1 of the TOR pathway