E F35

General

End Date: 

Monday, November 26, 2012 (All day)

Experiment Batch ID: 

e

Start Date: 

Monday, October 15, 2012 - 14:33

Experiment Contact: 

Publication: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

40

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

g18363_LsRictor

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F35

Fragment concentration: 

600.00ng/ul

Fragment length: 

421bp

Sense sequence: 

aatttgagggctcgattcctggagaataacaacgaagacgatgagttggatttgtctgaggggagttgtgttggggagaacgtgattgaggctctcaagtacctgtcctccaaaggagggtccaagggaaagaaactggcctatctgaacgcactcgtcaaagttctcttggaacagcggaaggattccttggaggaggatctgtctctgggcttgaggctcaaggaaatcatgctttgtctccgtattcctttgacccatgaagcggcagaagtgcgagctgcgactcttcgtgtgtttcgatacattgtggatcgtccttgcagagtccaggatttccttcaaatcaatgctcacctccttgtttcaagatgcatcgacatcgacctggacaatcgagtagaaagactgcaagccctgc

Fragment Producer: 

licelab

Primer Group: 

Rictor_f_b920
Validation

Efficacy of Knock Down: 

F>35.00%
Phenotype

Phenotype CV: 

Number of Individuals (End): 

23

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Downregulation of a Component of the TOR pathway