T F181

General

End Date: 

Tuesday, December 9, 2014 (All day)

Experiment Batch ID: 

T

Start Date: 

Thursday, October 30, 2014 - 09:00

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F181

Fragment concentration: 

600.00ng/ul

Fragment length: 

476bp

Sense sequence: 

ACGGTTCCTAGTGCATGTCTCTGATAGTGCTAAAATTGTAGCCATTTACTTTGAAGGGGATAAACCTCATAAGAACCTACTCAAAGGTATTGCTTCCCTCTTTCTATACAAAACAACTCCTTGGGAAGGTTGGCAAAGAGATGTCTCCGGTGACTGCTATGTTCGATATAAAACTAAGAATGAGAATCGGATGTTGAGGTTAAAGGATGAGTGTCTATCTGAAGATACAATGAAGCATAAGCTTCATGATGAATCGGGATCCACGGAATGGAGTTCCGAGACTCTCATTGATTTGAAAAAGGATAAATCGATACTCAAAGTGGAGTTAGTCGAGAATTTGGTAAAAAGGGATCCGTTGATGGGGGATTATGAGATTGAGTCACGGCAAGACATCATGTTGAGTGAGTATGACTTCATAGATGATGTTGTCCCAGAGGATAAATATCTCACTGTAAAGGAAGTCATAGATGCAGTGG

Fragment Producer: 

licelab

Primer Group: 

Phenotype

Phenotype: 

All animals with short and abnormal egg strings, few animals with no egg strings

Number of Individuals (End): 

10

Gallery Image: 

Upload

Image Quality: 

0
No votes yet

Microsomal triglyceride transfer protein (MTP) is necessary for lipoprotein assembly. A member of large lipid transfer protein (LLTP) gene family.