AF F241

General

End Date: 

Wednesday, June 8, 2016 - 09:53

Experiment Batch ID: 

AF

Start Date: 

Wednesday, April 27, 2016 - 09:53

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

T2_2443

Primary target ID: 

Fragment description

Fragment Label ID: 

F241

Fragment Batch ID: 

AF

Fragment concentration: 

600.00ng/ul

Fragment length: 

538bp

Sense sequence: 

tgtagaccccactgtgcgccatactttttggactcaattaattggaggaatattcactgctataaccatatatggtgtgaatcaatcccaagttcagagattgctcaccatcggcagtttaaaacgttcccaaggatctctttggatacaatggcctataatggcttctcttagctttttgacgtcttttgcaggtcttactatgtatacatactataaggactgtgatcccgtacaaagtaaacgtattccaaggggagatcaattattggctctatttgtaatggatamaawgagkaattactacggrataacagggktatttgtggcaggratattctctggrtccttgagtactgtttcatcatccattaactcacttgctgcagtatctctcgaagactacattaaaccccttgttaaagtacctccgaaaatggaaactttggttttaaaattccttgttcttttttacggagttcttagtatcatacttgcttttctctgcgagtttttgccaagtggtattttgcaggcc
Phenotype

Phenotype CV: 

Number of Individuals (End): 

21

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Knockdown av listefyll.

Nedregulering er ikke verifisert vha qPCR.