X F210

General

End Date: 

Wednesday, April 22, 2015 - 00:00

Experiment Batch ID: 

X

Start Date: 

Tuesday, March 17, 2015 - 09:00

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F210

Fragment concentration: 

600.00ng/ul

Fragment length: 

417bp

Sense sequence: 

TCATCTCTGCCTCAACGACATGTAATTCTGACAATGAATTCAAATGTCATAATGGGATC TGCATACCAAAATATCATGTATGCGACGGGATTTCTCATTGTCGAGATTCATCTGATGAA AATTTTTGTCTCCAAGAAAAAAGATCAAGATCAGATAATGAGGGTGTTGTCAGTATAATT GCTTCGTTTCGAGATTCATTCAGGAATTTTGTAAGGGACATAATGAAAGAAGTCGGAACC CTTCTAAGACGAAAGAAATCTGAT GGTGGTGCTGAGACAGTTGAATGCAAGAGTAATGAT GCCTTCTTTTGTTCAGTTGATAACATTTGTATATCTCTTTCTGCAAGATGTGATACAAAA GATGATTGCTCGGATGGAGAAGACGAAAATCCAAATAT TTGTGACTTCTTAGGCGGCT

Fragment Producer: 

licelab
Phenotype

Phenotype: 

Eggstrings curly and strange. Less copepodids were seen in RNAi group

Number of Individuals (End): 

5

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Similar to lipoprotein receptor