G F47

General

End Date: 

Tuesday, January 29, 2013 - 10:06

Experiment Batch ID: 

G

Start Date: 

Thursday, December 20, 2012 - 10:57

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

36

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Label ID: 

F47

Fragment Batch ID: 

G

Fragment concentration: 

600.00ng/ul

Fragment length: 

534bp

Sense sequence: 

ggaaatgtggaggagattgggcacttgttactggctcaacggatgggattgggaaggcttatgctagggctttggcttctaaaggtttaaatattatattgattagtcgaacgttgagtaagctagaaggagtgtcccaagaaataaaagaagaatttggagttaaagtaaagataattgacgttgatttctcaaaggatcctaatgtagactacgcaagtcgcatcgaacaggaaatatccaaacttaaaataggagtgttggtaaataatgtgggaatgagctatgagcatcctgaagaatacttagacattgaaaatggtgacgaagttgtctcgaaaattgtatcctgtaacatcacctctctaaataccatggtgaggctcgtattacctcaaatgaagaatcgtggaagaggagctgtc
Phenotype

Phenotype: 

No visible phenotype

Number of Individuals (End): 

12

Image file: 

Upload

Image Quality: 

0
No votes yet

Old Experiment.