Rhabdovirus - No9+127 Specificity

General

Experiment Description: 

To analyze the specificity of the knock-down, nauplius I from three females positive for both viruses were each divided into five groups. One group were not added any dsRNA (untreated) while the rest of the groups were added control dsRNA, N protein dsRNA from the No9 strain, N protein dsRNA from the No127 strain, or N protein dsRNA from both No9 and No127 strain. Samples were taken at 0, 4 and 8 days after soaking for analyzing the viral N protein RNA level. Reference: see Øvergård et al 2017; RNAi-mediated treatment of two vertically transmitted rhabdovirus infecting the salmon louse (Lepeophtheirus salmonis).

Experiment Batch ID: 

Exp2

Start Date: 

Sunday, April 19, 2015 - 14:11

Experiment Contact: 

Publication: 

Sample

Developmental Stage CV: 

Nauplius I
Copepodid

Number of Individuals (Start): 

540

Sex: 

unknown

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

FNo9
FNo127

Fragment concentration: 

3000.00ng/ul

Fragment length: 

896bp

Sense sequence: 

No9: ttctcccggaccgacatggaaacagagtttcatgttaatctatccaagcccggtattcaatcacaatatccatctgagtggttttctgctggaaacaaaaggcccagtgtgtccgtgaaggtcccaacaacgtatctgaaaaaggagtcaagagattacttttgtaatctcctaaacaactcattgacagtccccgaatggtcaacgatccaagggatggtctggctctcggagatgtatcctagtcaactgaaggggaatgatgtactagagtcattcgggataaagttaactgatgataaaaaccaggtgacggtcaaatcaattcttaactatgccgaggtagaggatcccactactacactcaaacccccagccaacaacaaaacagaatggactgaccaggagtactttgtcgggattacggcagtactggtcagttaccggtatcacagacttgtgcacgaggaggggagggaggccttactgagaagattagccggaatgctgacatctcaaacgctaagccttgcgtctattgttcggaaagccctcccagaacccggcgaagacatgaggaaggttatggcagcgctagatctccagttcaaccttggagatgggaaccccgaattcaaaagagtcaggatggggacagttcatctgcttcagagggatcagacatttctaagtgaagttcttgccatatctggttggtttgggaccgagtcctatgaaatgatcaaatggattttctctgccgaggtagcgaaggaggtcagagatagattttctcatgcagacgaggaagcaggacaacaattttcttactctgcctatatgattgatttcgggatttccaacagatctccttactcagtcaccgccaatccctt No127: ggagccatcggaggttatgacctgggtgactcttgattccgtctcgactgagatcttgaagaccgtcagagatactgaggaaatttattgtcctttctcttatgccccctatatgatggatctcgggatatcagctaagtctccgtattcggtcacagaaaatcctttgtctcacctatggattcatgtgacaggagtaatattaaataacccgcgatctatgaatgcccggattatcggggagaccacatttcatcaggtaattttgtcctccgccctcctggcttatcggtgcgcaacaagtcctttattgagtcaaaagttcagtggacaatccgacctcagaggggtagaagagagtattagggtcttgtcggagtcaagttcatatttctcaaacactgaggatcttgatctggaagacgatccacaacaaaacactcccatggcatacgtcgcttggtgtgacaacaagtggaaccgtcgactttttacatttgtagactccgcaatgctaggattgacacggcccctt

Fragment Mixture Formula: 

FNo9+FNo127

Fragment Producer: 

Aina-Cathrine Øvergård
Validation

Efficacy of Knock Down: 

F>94.00%
Phenotype

Number of Individuals (End): 

540
Upload

Image Quality: 

0
No votes yet

n