Rhabdovirus - No9 prod of virus free strains

General

Experiment Description: 

Test if it is possible to cure lice for rhabdovirus. Used LsGulen strain that only have LsRV-No9 strain. Treatment given only at Nauplius I stage. Copepods (80/fish) were given to 6 fish, and sampled at 8, 25 and 55 days post infestation.

Experiment Batch ID: 

Exp3

Start Date: 

Monday, February 2, 2015 - 14:11

Experiment Contact: 

Publication: 

Sample

Developmental Stage CV: 

Nauplius I
Adult

Number of Individuals (Start): 

480

Sex: 

unknown

Organism: 

Target description

Gene or target symbol: 

N protein LsRV-No9

Target type: 

Viral

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

FNo9

Fragment concentration: 

1500.00ng/ul

Fragment length: 

896bp

Sense sequence: 

No9: ttctcccggaccgacatggaaacagagtttcatgttaatctatccaagcccggtattcaatcacaatatccatctgagtggttttctgctggaaacaaaaggcccagtgtgtccgtgaaggtcccaacaacgtatctgaaaaaggagtcaagagattacttttgtaatctcctaaacaactcattgacagtccccgaatggtcaacgatccaagggatggtctggctctcggagatgtatcctagtcaactgaaggggaatgatgtactagagtcattcgggataaagttaactgatgataaaaaccaggtgacggtcaaatcaattcttaactatgccgaggtagaggatcccactactacactcaaacccccagccaacaacaaaacagaatggactgaccaggagtactttgtcgggattacggcagtactggtcagttaccggtatcacagacttgtgcacgaggaggggagggaggccttactgagaagattagccggaatgctgacatctcaaacgctaagccttgcgtctattgttcggaaagccctcccagaacccggcgaagacatgaggaaggttatggcagcgctagatctccagttcaaccttggagatgggaaccccgaattcaaaagagtcaggatggggacagttcatctgcttcagagggatcagacatttctaagtgaagttcttgccatatctggttggtttgggaccgagtcctatgaaatgatcaaatggattttctctgccgaggtagcgaaggaggtcagagatagattttctcatgcagacgaggaagcaggacaacaattttcttactctgcctatatgattgatttcgggatttccaacagatctccttactcagtcaccgccaatccctt

Fragment Mixture Formula: 

FNo9

Fragment Producer: 

Aina-Cathrine Øvergård
Validation

Efficacy of Knock Down: 

F>41.00%
Upload

Image Quality: 

0
No votes yet

n