Rhabdovirus - No9 prod of virus free strains


Experiment Description: 

Test if it is possible to cure lice for rhabdovirus. Used LsGulen strain that only have LsRV-No9 strain. Treatment given only at Nauplius I stage. Copepods (80/fish) were given to 6 fish, and sampled at 8, 25 and 55 days post infestation.

Experiment Batch ID: 


Start Date: 

Monday, February 2, 2015 - 14:11

Experiment Contact: 



Developmental Stage CV: 

Nauplius I

Number of Individuals (Start): 





Target description

Gene or target symbol: 

N protein LsRV-No9

Target type: 


Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 


Fragment concentration: 


Fragment length: 


Sense sequence: 

No9: ttctcccggaccgacatggaaacagagtttcatgttaatctatccaagcccggtattcaatcacaatatccatctgagtggttttctgctggaaacaaaaggcccagtgtgtccgtgaaggtcccaacaacgtatctgaaaaaggagtcaagagattacttttgtaatctcctaaacaactcattgacagtccccgaatggtcaacgatccaagggatggtctggctctcggagatgtatcctagtcaactgaaggggaatgatgtactagagtcattcgggataaagttaactgatgataaaaaccaggtgacggtcaaatcaattcttaactatgccgaggtagaggatcccactactacactcaaacccccagccaacaacaaaacagaatggactgaccaggagtactttgtcgggattacggcagtactggtcagttaccggtatcacagacttgtgcacgaggaggggagggaggccttactgagaagattagccggaatgctgacatctcaaacgctaagccttgcgtctattgttcggaaagccctcccagaacccggcgaagacatgaggaaggttatggcagcgctagatctccagttcaaccttggagatgggaaccccgaattcaaaagagtcaggatggggacagttcatctgcttcagagggatcagacatttctaagtgaagttcttgccatatctggttggtttgggaccgagtcctatgaaatgatcaaatggattttctctgccgaggtagcgaaggaggtcagagatagattttctcatgcagacgaggaagcaggacaacaattttcttactctgcctatatgattgatttcgggatttccaacagatctccttactcagtcaccgccaatccctt

Fragment Mixture Formula: 


Fragment Producer: 

Aina-Cathrine Øvergård

Efficacy of Knock Down: 


Image Quality: 

No votes yet

Knock-down 8 dpi: 92%
Knock-down 25 dpi (females): 55%
Knock-down 55 dpi (females): 41%