AS F0

General

End Date: 

Monday, September 24, 2018 - 09:08

Experiment Description: 

Control

Experiment Batch ID: 

AS

Start Date: 

Tuesday, August 21, 2018 - 09:08

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

CPY

Primary target ID: 

Fragment description

Fragment Label ID: 

F0

Fragment Batch ID: 

F0

Fragment concentration: 

600.00ng/ul

Sense sequence: 

TGCTTGAGAGGATGGTCGAATCCGATTGAATGGTGTAAAACTCCAATTTGTAATATAAATGGAAATTCGTGCCTAAATGGGAAGTGTATTTTACCTAATACATGTGCATGCCATGTGGGTTGGGATGGATCCATCTGTGATAAATGTATTCCAAGAGGAGGATGTCAAAACGGAGATTGTGATAATCCCTTTGAATGCAATTGTTCGGAAGGTTGGTCCGGATATAATTGTGATAAAGTAGATTGCCAAAATTGCGTGAATGGAAAATGTACCGAACCGAACCAGTGCATATGTAATCCGGGATGGGTTGGAGATAAATGTGACAAATGCGTCAAAAAACCGGGATGTTTACATGGAAATTGCAACAACAAACCACATGAATGTGAGTGCAGAGAAGGATGGACAGGAGAACTATGCGATATCCCCATTTGCCTTGAAGGATGCCATCCCCAATTTGGAACAT GAGGGCTGGTTCGGATATAATTGTGATAAAGCAAAATGCGACTTTTGCAAGAATGGTAAATGTTTGGAGCCGAACAAGTGCATATGTAATCAAGGATGGGAGGGAGATCAATGCGATCAATGCGTCAAAAAACCAGGATGTCAAAATGGATATTGTCAAAACAAACCACATGAATGCAAGTGTAGAGAAGGATGGAAAGGAGATCTATGCAATATCCCTATTTGCCTAGAAGAATGTGATCCCAAATTTGGATTCTGCGATAAGCCAGGGGAATGCAAATGTATTACTGGGTGGACAGGCCCATTATGTACGATGAAAGAGTGTTCTGTTGTATGTGATTTGGCCAATAGTGAATGTGAAATGGGTATGTGTGTCTGTAAAGAAGGATGGACCGGAGCTAAATGCGATGAATGCATCCCAAAACTAGGCTGTGTTAACGGCGAGTGTAAAGACCA

Fragment Mixture Formula: 

F0
Phenotype

Number of Individuals (End): 

14
Upload

Image Quality: 

0
No votes yet

standard control fragment