Heme peroxidase F415

General

Experiment Description: 

Double knockdown of two heme peroxidases (EMLSAT00000013034 + EMLSAT00000013035) in teg2 glands.

Experiment Batch ID: 

AW F415

Start Date: 

Friday, April 26, 2019 - 09:00

Experiment Contact: 

Sample

Developmental Stage CV: 

Adult

Number of Individuals (Start): 

35

Sex: 

female

Organism: 

Target description
Fragment description

Antisense sequence: 

Fragment Label ID: 

F415

Fragment Batch ID: 

Fragment concentration: 

1000.00ng/ul

Sense sequence: 

>13034_FP CCATTCGGGCAAGATCTAATGTCA >13034_RP GGTACTTTGGTGGATCCATGTATAAATAC >13035_FP CCCTGATAGATTTATAATCGATGATGTTAC >13035_RP GTTTCCTAATGCTTTTGATTTGCTCAAA

Fragment Mixture Formula: 

Fragment Producer: 

Primer Group: 

Phenotype

Phenotype: 

Upload

Image Quality: 

0
No votes yet

Double knockdown of two heme peroxidases in adult female lice.