Mucin-like spermatophore wall protein 1 (AG F269)

General

End Date: 

Friday, September 23, 2016 - 15:04

Experiment Description: 

knockdown in males, checking female phenotype

Experiment Batch ID: 

AG

Start Date: 

Tuesday, August 16, 2016 - 15:03

Experiment Contact: 

Publication: 

Sample

Developmental Stage CV: 

adult male

Sex: 

male

Organism: 

Target description

Gene or target symbol: 

MLSWP1

Primary target ID: 

Fragment description

Antisense sequence: 

TTACGTTGGCAATCGTCGTC

Fragment Label ID: 

F269

Fragment concentration: 

600.00ng/ul

Fragment length: 

527bp

Sense sequence: 

GAAATCAAGTGCGGCTCCA
Validation

Efficacy of Knock Down: 

F>95.00%
Phenotype

Phenotype: 

females missing eggstrings/producing no off-spring

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Gene 7670 is male-specific expressed, a role in reproduction is assumed. Test if knockdown in males affects their reproductive success. It obviously does.