J F18

General

End Date: 

Monday, March 11, 2013 (All day)

Experiment Description: 

EcR was knocked down to see verify possible knock down after 12 days.

Experiment Batch ID: 

RNAJ

Start Date: 

Wednesday, February 27, 2013 - 15:02

Experiment Contact: 

Publication: 

Sample

Developmental Stage CV: 

PreAdult
Adult

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

18

Fragment concentration: 

600.00ng/ul

Fragment length: 

667bp

Sense sequence: 

ccgcagctgcagccgacacaactgtagatcctaagtccaataacaacggtaaaaatggaagcatatccatagatatggcttcttttcctaaaagactttcatccaccaaacctttaaagccagaagaagaggagctaattaatcgtttggtatattttcaagaagaatacgagcatccatctgaagcggaccttaaccgtgtttaccatgttcctatgcacagtactaattcatccgaatccgagtctgaccgtttattccgtcatatgacagagatgactattcttacagttcaattaatagttgagttctccaagcacctgccgggcttccagaatctttgcagagacgatcaaattaatttacttaaaggctgttcctcagaagtgatgatgctgaggggagcccgtcgttatgatgccgagtcagactctattgtttatgcaacgaactatccttttacgaaagaaaattacgctaaggcggggcttggcaatgacgagctctttcgtttctgcagggccatgtctcgaatgaaagtagataacgcagaatacgctctcataacagctattgtcatttttagtgatagaaactccttaaaggaacctaaaagagttgaaaagattcaagagatttatgtagatgctctacaagcctacgtaatggcaaatcgg

Fragment Producer: 

Heidi

Primer Group: 

likb327_b734
Validation

Efficacy of Knock Down: 

F>20.00%
Phenotype

Number of Individuals (End): 

18

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

All lice was lacking eggstrings however, this was expected as the lice were not mature when collected.

This experiment was conducted in order to possibly quantify a statistically significant knockdown of EcR. approx: 50 % knock down copmared to the control lice was detected.