F F41

General

End Date: 

Tuesday, January 29, 2013 - 10:06

Experiment Batch ID: 

G

Start Date: 

Monday, October 15, 2012 - 10:57

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

g19454_iCAT

Primary target ID: 

Fragment description

Fragment Label ID: 

F41

Fragment Batch ID: 

F

Fragment concentration: 

600.00ng/ul

Fragment length: 

459bp

Sense sequence: 

tcgctccagcatcaattcgaccttcaggaggactaaataggtgtttatctacttttgacttaacaacacttgggattggagccacattaggcgttggaatatatgttttatctggatctgttgctcgtgacatagctggaccttcaattatattttccttcctgctggctgggattgcttctgctctttcaggtctgtgctatgcagagttaggttccagagtacctttggctggatcagcatatgtgtatagctatgttactgttggggaattaattgggttcattattggatggaatctcattctggaatatgcaataggaacagcaagtgtggcaaagggttattctggatatttggattcactttttggagggatattttcatcatatttgaagatgtactttcctatcaatgtaccatatcttagtacatatcctgatctcattgctctcggca
Phenotype

Phenotype: 

No visible phenotype

Number of Individuals (End): 

10
Upload

Image Quality: 

0
No votes yet

Old Experiment
g6339 scaffold or stable-ID 2032(primers don't match correctly)