2965

General

End Date: 

Sunday, January 8, 2017 - 10:14

Experiment Description: 

Experiment Batch ID: 

n

Start Date: 

Sunday, January 1, 2017 - 10:03

Experiment Contact: 

Sample

Developmental Stage CV: 

Nauplius

Sex: 

unknown

Organism: 

Target description

Gene or target symbol: 

HSP70/HSC70

Target type: 

Primary target ID: 

Fragment description

Antisense sequence: 

GCCATTGGAATCGATCTAGGA

Fragment Label ID: 

F

Fragment Batch ID: 

Sense sequence: 

CAGCCGTGGGCTCATTAAA

Fragment Mixture Formula: 

Fragment Producer: 

Phenotype

Phenotype: 

No visible phenotype
Upload

Image Quality: 

0
No votes yet

Knockdown of 6502.
Variations are too big to see a downregulation