AN F336

General

End Date: 

Wednesday, January 3, 2018 - 23:23

Experiment Description: 

injection into preadult 1 males, added virgin females 10 days later, checked reproduction

Experiment Batch ID: 

AN

Start Date: 

Wednesday, November 1, 2017 - 07:35

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult1
Adult

Number of Individuals (Start): 

60

Sex: 

male

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Antisense sequence: 

TACGTCCAGGGACGCAGT CAGGAACACAGTCTTGGAACGTA AAAAGTTATCTGCGTCCAGGAA

Fragment Label ID: 

F336

Fragment concentration: 

600.00ng/ul

Fragment length: 

400bp

Sense sequence: 

AAGATGTCTCGTGGAATGAGTTG AAAAATTCAAATATGTCTCGTGGAA TCAAAGATGTCTCGTGGAATGG

Fragment Producer: 

licelab
Validation

Efficacy of Knock Down: 

F>75.00%
Upload

Image Quality: 

0
No votes yet

Knockdown of a testis-specific ion-pump in pre-adult1 males, checking reproduction in adults. Many males were lost, and no kncokdown observed.