H F59

General

End Date: 

Monday, February 25, 2013 - 00:00

Experiment Batch ID: 

H

Start Date: 

Tuesday, January 15, 2013 - 13:29

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Label ID: 

F59

Fragment concentration: 

400.00ng/ul

Fragment length: 

484bp

Sense sequence: 

acttgcttgtcttttctcggcatcaatatgcactcaacaatcagaagaggaatcatctaaattgcaactcagtgtatactatgagacaatgtgcccttattgcaaaaggcatatactggaagatttgcacccaacatatactcaactgagtgatatattggatgttcaattagtaccatatgggaatgctaagtcttcttcaagaccagacggaacaggctatacattttcttgtcagcatggccctacagagtgccttggaaatatggttcatgcctgtgcaattaaatatgtcaaattccccattctcatggatttcattgcatgtatgatggaaagaagtgatgtacccgttcttgcaaaaaaagagtgtgcaagtaaattggaaattgaatggactgaaattgaggagtgttccatgtcccttg

Fragment Producer: 

Heidi

Primer Group: 

g9531_f_b1311
Validation

Efficacy of Knock Down: 

F>0.00%
Phenotype

Phenotype CV: 

Number of Individuals (End): 

9

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Animals appeared normal. Nothing significant within the periode the experiment was performed. QPCR validation shows an upregulation of 20-100% depending on removal of one suspicious sample