no visible phenotype

Rhabdovirus - No9+127 prod of virus free strain

Phenotype CV: 

General

Experiment Batch ID: 

Exp6

Experiment Contact: 

Start Date: 

16 January, 2017 - 14:11

Experiment Description: 

Test if it is possible to cure lice for two rhabdovirus simultaneously. Used lice taken from Hardanger fjord that was infected with both LsRV-No9 and No127 strains. Treatment given at Nauplius I and pre-adult stage. Copepods (80/fish) were given to 6 fish, and sampled at 25 days post infestation. Pre-adult lice were given 600 ng/ul dsRNA by injection and sampled at 55 dpi.
Sample

Organism: 

Sex: 

unknown

Number of Individuals (Start): 

480

Developmental Stage CV: 

Nauplius I
Adult
Target description
Fragment description

Fragment length: 

896bp

Fragment concentration: 

3000ng/ul

Sense sequence: 

No9: ttctcccggaccgacatggaaacagagtttcatgttaatctatccaagcccggtattcaatcacaatatccatctgagtggttttctgctggaaacaaaaggcccagtgtgtccgtgaaggtcccaacaacgtatctgaaaaaggagtcaagagattacttttgtaatctcctaaacaactcattgacagtccccgaatggtcaacgatccaagggatggtctggctctcggagatgtatcctagtcaactgaaggggaatgatgtactagagtcattcgggataaagttaactgatgataaaaaccaggtgacggtcaaatcaattcttaactatgccgaggtagaggatcccactactacactcaaacccccagccaacaacaaaacagaatggactgaccaggagtactttgtcgggattacggcagtactggtcagttaccggtatcacagacttgtgcacgaggaggggagggaggccttactgagaagattagccggaatgctgacatctcaaacgctaagccttgcgtctattgttcggaaagccctcccagaacccggcgaagacatgaggaaggttatggcagcgctagatctccagttcaaccttggagatgggaaccccgaattcaaaagagtcaggatggggacagttcatctgcttcagagggatcagacatttctaagtgaagttcttgccatatctggttggtttgggaccgagtcctatgaaatgatcaaatggattttctctgccgaggtagcgaaggaggtcagagatagattttctcatgcagacgaggaagcaggacaacaattttcttactctgcctatatgattgatttcgggatttccaacagatctccttactcagtcaccgccaatccctt No127: ggagccatcggaggttatgacctgggtgactcttgattccgtctcgactgagatcttgaagaccgtcagagatactgaggaaatttattgtcctttctcttatgccccctatatgatggatctcgggatatcagctaagtctccgtattcggtcacagaaaatcctttgtctcacctatggattcatgtgacaggagtaatattaaataacccgcgatctatgaatgcccggattatcggggagaccacatttcatcaggtaattttgtcctccgccctcctggcttatcggtgcgcaacaagtcctttattgagtcaaaagttcagtggacaatccgacctcagaggggtagaagagagtattagggtcttgtcggagtcaagttcatatttctcaaacactgaggatcttgatctggaagacgatccacaacaaaacactcccatggcatacgtcgcttggtgtgacaacaagtggaaccgtcgactttttacatttgtagactccgcaatgctaggattgacacggcccctt

Fragment Label ID: 

FNo9
FNo127

Fragment Mixture Formula: 

FNo9+FNo127

Fragment Producer: 

Aina-Cathrine Øvergård

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>98%
Upload

Image Quality: 

0
No votes yet

n

Rhabdovirus - No9+127 prod of virus free strain

Phenotype CV: 

General

Experiment Batch ID: 

Exp5

Experiment Contact: 

Start Date: 

16 January, 2017 - 14:11

Experiment Description: 

Test if it is possible to cure lice for two rhabdovirus simultaneously. Used lice taken from Hardanger fjord that was infected with both LsRV-No9 and No127 strains. Treatment given at Nauplius I and pre-adult stage. Copepods (80/fish) were given to 6 fish, and sampled at 25 days post infestation. Pre-adult lice were given 600 ng/ul dsRNA by injection and sampled at 75 dpi. The offspring of these females were treated with dsRNA at Nauplius I and pre-adult stage as described above, and adult lice were sampled at 55 dpi.
Sample

Organism: 

Sex: 

unknown

Number of Individuals (Start): 

480

Developmental Stage CV: 

Nauplius I
Adult
Target description
Fragment description

Fragment length: 

896bp

Fragment concentration: 

3000ng/ul

Sense sequence: 

>No9: ttctcccggaccgacatggaaacagagtttcatgttaatctatccaagcccggtattcaatcacaatatccatctgagtggttttctgctggaaacaaaaggcccagtgtgtccgtgaaggtcccaacaacgtatctgaaaaaggagtcaagagattacttttgtaatctcctaaacaactcattgacagtccccgaatggtcaacgatccaagggatggtctggctctcggagatgtatcctagtcaactgaaggggaatgatgtactagagtcattcgggataaagttaactgatgataaaaaccaggtgacggtcaaatcaattcttaactatgccgaggtagaggatcccactactacactcaaacccccagccaacaacaaaacagaatggactgaccaggagtactttgtcgggattacggcagtactggtcagttaccggtatcacagacttgtgcacgaggaggggagggaggccttactgagaagattagccggaatgctgacatctcaaacgctaagccttgcgtctattgttcggaaagccctcccagaacccggcgaagacatgaggaaggttatggcagcgctagatctccagttcaaccttggagatgggaaccccgaattcaaaagagtcaggatggggacagttcatctgcttcagagggatcagacatttctaagtgaagttcttgccatatctggttggtttgggaccgagtcctatgaaatgatcaaatggattttctctgccgaggtagcgaaggaggtcagagatagattttctcatgcagacgaggaagcaggacaacaattttcttactctgcctatatgattgatttcgggatttccaacagatctccttactcagtcaccgccaatccctt >No127: ggagccatcggaggttatgacctgggtgactcttgattccgtctcgactgagatcttgaagaccgtcagagatactgaggaaatttattgtcctttctcttatgccccctatatgatggatctcgggatatcagctaagtctccgtattcggtcacagaaaatcctttgtctcacctatggattcatgtgacaggagtaatattaaataacccgcgatctatgaatgcccggattatcggggagaccacatttcatcaggtaattttgtcctccgccctcctggcttatcggtgcgcaacaagtcctttattgagtcaaaagttcagtggacaatccgacctcagaggggtagaagagagtattagggtcttgtcggagtcaagttcatatttctcaaacactgaggatcttgatctggaagacgatccacaacaaaacactcccatggcatacgtcgcttggtgtgacaacaagtggaaccgtcgactttttacatttgtagactccgcaatgctaggattgacacggcccctt

Fragment Label ID: 

FNo9
FNo127

Fragment Mixture Formula: 

FNo9+FNo127

Fragment Producer: 

Aina-Cathrine Øvergård

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>100%
Upload

Image Quality: 

0
No votes yet

n

NAH F186

Phenotype CV: 

General

Experiment Batch ID: 

NAH

Experiment Contact: 

Start Date: 

21 November, 2014 (All day)

End Date: 

12 January, 2015 (All day)
Sample

Organism: 

Sex: 

unknown

Number of Individuals (Start): 

300

Developmental Stage CV: 

Nauplius I
Adult
Target description

Primary target ID: 

Gene or target symbol: 

FLVCR2
Fragment description

Fragment length: 

533bp

Fragment concentration: 

10ng/ul

Fragment Label ID: 

F186

Primer Group: 

b2654

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

23
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

RNAi knockdown in nauplii of genes involved in iron or heme uptake, transport, storage or homeostasis, and with elevated expression from the parasitic copepodid stage. Infection of fish with knockdown copepodids (3 fish with 80 lice) and lice count after 16 and 42 days. No significant difference in number of lice on fish at termination. qPCR validation not done yet.

NAH F154

Phenotype CV: 

General

Experiment Batch ID: 

NAH

Experiment Contact: 

Start Date: 

21 November, 2014 (All day)

End Date: 

12 January, 2015 (All day)
Sample

Organism: 

Sex: 

unknown

Number of Individuals (Start): 

300

Developmental Stage CV: 

Nauplius I
Adult
Target description
Fragment description

Fragment length: 

541bp

Fragment concentration: 

10ng/ul

Fragment Label ID: 

F154

Primer Group: 

b2341

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

33
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

RNAi knockdown in nauplii of genes involved in iron or heme uptake, transport, storage or homeostasis, and with elevated expression from the parasitic copepodid stage. Infection of fish with knockdown copepodids (3 fish with 80 lice) and lice count after 16 and 42 days. No significant difference in number of lice on fish at termination. qPCR validation not done yet.

NAH F135

Phenotype CV: 

General

Experiment Batch ID: 

NAH

Experiment Contact: 

Start Date: 

21 November, 2014 (All day)

End Date: 

12 January, 2015 (All day)
Sample

Organism: 

Sex: 

unknown

Number of Individuals (Start): 

300

Developmental Stage CV: 

Nauplius I
Adult
Target description
Fragment description

Fragment length: 

602bp

Fragment concentration: 

10ng/ul

Fragment Label ID: 

F135

Primer Group: 

1854

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

34
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

RNAi knockdown in nauplii of genes involved in iron or heme uptake, transport, storage or homeostasis, and with elevated expression from the parasitic copepodid stage. Infection of fish with knockdown copepodids (3 fish with 80 lice) and lice count after 16 and 42 days. No significant difference in number of lice on fish at termination. qPCR validation not done yet.

NAH F0

Phenotype CV: 

General

Experiment Batch ID: 

NAH

Experiment Contact: 

Start Date: 

21 November, 2014 (All day)

End Date: 

12 January, 2015 (All day)
Sample

Organism: 

Sex: 

unknown

Number of Individuals (Start): 

300

Developmental Stage CV: 

Nauplius I
Adult
Target description

Primary target ID: 

Gene or target symbol: 

CPY 185
Fragment description

Fragment concentration: 

10ng/ul

Fragment Label ID: 

F0

Primer Group: 

Phenotype

Number of Individuals (End): 

20
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

RNAi knockdown in nauplii of genes involved in iron or heme uptake, transport, storage or homeostasis, and with elevated expression from the parasitic copepodid stage. Infection of fish with knockdown copepodids (3 fish with 80 lice) and lice count after 16 and 42 days. One fish died 18.12.2014 -> results missing. No significant difference in number of lice on fish at termination. qPCR validation not done yet.

S F186 (FLVCR2)

Phenotype CV: 

General

Experiment Batch ID: 

S

Experiment Contact: 

Start Date: 

14 October, 2014 - 11:05

End Date: 

14 November, 2014 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

Adult
Adult
Target description

Primary target ID: 

Gene or target symbol: 

FLVCR2
Fragment description

Fragment length: 

533bp

Fragment concentration: 

600ng/ul

Fragment Label ID: 

F186

Primer Group: 

b2654

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

23
Upload

Image Quality: 

0
No votes yet

RNAi with adult females. No visible phenotype. No hatching data from IMR. qPCR validation not done yet. Fotos (RS160-179, RFS28-30) at P:\Sealice\RNAi\RNAi_fotos_samplet\Experiment_S\RNAiS.

S F172 (FLVCR)

Phenotype CV: 

General

Experiment Batch ID: 

S

Experiment Contact: 

Start Date: 

14 October, 2014 - 11:05

End Date: 

14 November, 2014 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

29

Developmental Stage CV: 

Adult
Adult
Target description
Fragment description

Fragment length: 

513bp

Fragment concentration: 

600ng/ul

Fragment Label ID: 

F172

Primer Group: 

b2352

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

24
Upload

Image Quality: 

0
No votes yet

RNAi with adult females. No visible phenotype. No hatching data from IMR. qPCR validation not done yet. Fotos (RS18-38, RFS4-6) at P:\Sealice\RNAi\RNAi_fotos_samplet\Experiment_S\RNAiS.

R F171 (Fepo)

Phenotype CV: 

General

Experiment Batch ID: 

R

Experiment Contact: 

Start Date: 

21 August, 2014 - 10:23

End Date: 

30 September, 2014 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

Fepo (Ferroportin)
Fragment description

Fragment length: 

661bp

Fragment concentration: 

600ng/ul

Fragment Label ID: 

F171

Primer Group: 

b2335

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

22
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

RNAi with preadult females. No visible phenotype. Hatching rate not determined yet, but looks no different from control. qPCR validation not done yet.

R F170 (DcytB)

Phenotype CV: 

General

Experiment Batch ID: 

R

Experiment Contact: 

Start Date: 

21 August, 2014 - 10:23

End Date: 

30 September, 2014 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description
Fragment description

Fragment length: 

546bp

Fragment concentration: 

600ng/ul

Fragment Label ID: 

F170

Primer Group: 

b2329

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

19
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

RNAi with preadult females. No visible phenotype. Hatching rate not determined yet, but looks no different from control. qPCR validation not done yet.

Pages

Subscribe to RSS - no visible phenotype