no visible phenotype

AV F353

Phenotype CV: 

General

Experiment Batch ID: 

AV

Experiment Contact: 

Start Date: 

14 March, 2019 - 09:00

End Date: 

24 April, 2019 - 09:00

Experiment Description: 

Repeat of downregulation of 4874 Var 2_2
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

4874_Var2_2

Target type: 

Fragment description

Fragment length: 

342bp

Fragment concentration: 

600ng/ul

Sense sequence: 

Antisense sequence: 

catgaatgagtctggcttaaacttaaaatacccctcgagttatcatgaagaaattaatccaactgtcgcctctgttttcgttgctgctgcatacagatttggccattccatgattcaaaggaatgtgaatcgattggctataaaaaaatatagctatagcagtaattattccttatttaaggacttttttaatacggcaaattacgaggataggaatgggctaggaatagaagaaattttatatgggttgacctatttcccagcacaatctgcagaccgttttgttgtaaaagaagtaactaattatttgttcaataatggaaagccgtatggagcagatct

Fragment Batch ID: 

Fragment Label ID: 

F353

Fragment Mixture Formula: 

Primer Group: 

likb2502_T7_b2515

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

14

Phenotype: 

normal
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Repeat of downregulation of 4874. var 2_2

 

AP F353

Phenotype CV: 

General

Experiment Batch ID: 

AP

Experiment Contact: 

Start Date: 

7 March, 2018 - 13:26

End Date: 

10 April, 2018 - 10:54

Experiment Description: 

Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

4874 Var2_2

Target type: 

Fragment description

Fragment length: 

342bp

Fragment concentration: 

600ng/ul

Sense sequence: 

Antisense sequence: 

catgaatgagtctggcttaaacttaaaatacccctcgagttatcatgaagaaattaatccaactgtcgcctctgttttcgttgctgctgcatacagatttggccattccatgattcaaaggaatgtgaatcgattggctataaaaaaatatagctatagcagtaattattccttatttaaggacttttttaatacggcaaattacgaggataggaatgggctaggaatagaagaaattttatatgggttgacctatttcccagcacaatctgcagaccgttttgttgtaaaagaagtaactaattatttgttcaataatggaaagccgtatggagcagatct

Fragment Batch ID: 

Fragment Label ID: 

F353

Fragment Mixture Formula: 

Fragment Producer: 

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

14

Phenotype: 

Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Downregulation of 4874 Var 2_2

AV F352

Phenotype CV: 

General

Experiment Batch ID: 

AV

Experiment Contact: 

Start Date: 

14 March, 2019 - 09:00

End Date: 

24 April, 2019 - 09:00

Experiment Description: 

Repeat of downregulation of 4874 Var 2_1
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

4874_Var2_1
Fragment description

Fragment length: 

322bp

Fragment concentration: 

600ng/ul

Sense sequence: 

tcaagcgacgaggaattattgctactcaaggaagaaaattcttacttaatgaagagtacgctgactgatgatggaaaagaactccttcccaaagatggtaaaggtagttttgtgggaggagacgctagagctcttctaaccactggtttggcttcagttcataccttattcgttcgggaacataatcgaatatcaaggaaacttgctcagatgaatccttcatacacaaacgaaactgtttttcaagaaactcggcgaatattgggagcaatgatgcaaaatattgtttatagtgaatttcttccgacgttattaggggaaa

Fragment Label ID: 

F352

Primer Group: 

likb2502_T7_b2515

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

11

Phenotype: 

normal
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Repeat of downregulation of 4874. var 2_1

 

AV F353

Phenotype CV: 

General

Experiment Batch ID: 

AV

Experiment Contact: 

Start Date: 

14 March, 2019 - 09:00

End Date: 

24 April, 2019 - 09:00

Experiment Description: 

Downregulation of variant 2_2
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description
Fragment description

Fragment length: 

670bp

Fragment concentration: 

600ng/ul

Sense sequence: 

tcaagcgacgaggaattattgctactcaaggaagaaaattcttacttaatgaagagtacgctgactgatgatggaaaagaactccttcccaaagatggtaaaggtagttttgtgggaggagacgctagagctcttctaaccactggtttggcttcagttcataccttattcgttcgggaacataatcgaatatcaaggaaacttgctcagatgaatccttcatacacaaacgaaactgtttttcaagaaactcggcgaatattgggagcaatgatgcaaaatattgtttatagtgaatttcttccgacgttattaggggaaaaaagcatgaatgagtctggcttaaacttaaaatacccctcgagttatcatgaagaaattaatccaactgtcgcctctgttttcgttgctgctgcatacagatttggccattccatgattcaaaggaatgtgaatcgattggctataaaaaaatatagctatagcagtaattattccttatttaaggacttttttaatacggcaaattacgaggataggaatgggctaggaatagaagaaattttatatgggttgacctatttcccagcacaatctgcagaccgttttgttgtaaaagaagtaactaattatttgttcaataatggaaagccgtatggagcagatcttg

Fragment Label ID: 

F353

Primer Group: 

likb2502_T7_b2515

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

11

Phenotype: 

normal
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Downregulation of 4874. F352 and F353 are different fragment from the same gene

AV F352

Phenotype CV: 

General

Experiment Batch ID: 

AV

Experiment Contact: 

Start Date: 

14 March, 2019 - 09:00

End Date: 

24 April, 2019 - 09:00

Experiment Description: 

Downregulation of Var 2_1
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description
Fragment description

Fragment length: 

670bp

Fragment concentration: 

600ng/ul

Sense sequence: 

tcaagcgacgaggaattattgctactcaaggaagaaaattcttacttaatgaagagtacgctgactgatgatggaaaagaactccttcccaaagatggtaaaggtagttttgtgggaggagacgctagagctcttctaaccactggtttggcttcagttcataccttattcgttcgggaacataatcgaatatcaaggaaacttgctcagatgaatccttcatacacaaacgaaactgtttttcaagaaactcggcgaatattgggagcaatgatgcaaaatattgtttatagtgaatttcttccgacgttattaggggaaaaaagcatgaatgagtctggcttaaacttaaaatacccctcgagttatcatgaagaaattaatccaactgtcgcctctgttttcgttgctgctgcatacagatttggccattccatgattcaaaggaatgtgaatcgattggctataaaaaaatatagctatagcagtaattattccttatttaaggacttttttaatacggcaaattacgaggataggaatgggctaggaatagaagaaattttatatgggttgacctatttcccagcacaatctgcagaccgttttgttgtaaaagaagtaactaattatttgttcaataatggaaagccgtatggagcagatcttg

Fragment Label ID: 

F352

Primer Group: 

likb2502_T7_b2515

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

11

Phenotype: 

normal
Upload

Image Quality: 

0
No votes yet

Downregulation of 4874

AV F350

Phenotype CV: 

General

Experiment Batch ID: 

AV

Experiment Contact: 

Start Date: 

14 March, 2019 - 09:00

End Date: 

24 April, 2019 - 09:00

Experiment Description: 

Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Target type: 

Fragment description

Fragment concentration: 

600ng/ul

Sense sequence: 

Antisense sequence: 

Fragment Batch ID: 

Fragment Label ID: 

F350

Fragment Mixture Formula: 

Primer Group: 

likb2502_T7_b2515

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

20

Phenotype: 

normal
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Downregulation of 9839

AV F0 extra

Phenotype CV: 

General

Experiment Batch ID: 

AV

Experiment Contact: 

Start Date: 

14 March, 2019 - 09:00

End Date: 

24 April, 2019 - 09:00

Experiment Description: 

Extra control to Mvp1 and Mvp2/3 knock-down
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

CPY185
Fragment description

Fragment concentration: 

600ng/ul

Fragment Label ID: 

F0

Primer Group: 

likb2502_T7_b2515

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

17

Phenotype: 

normal
Upload

Image file: 

Image Quality: 

0
No votes yet

Extra control to Knock-down of all MVP. 

AV F364 (F168+F169)

Phenotype CV: 

General

Experiment Batch ID: 

AP

Experiment Contact: 

Start Date: 

14 March, 2019 - 09:00

End Date: 

24 April, 2019 - 09:00

Experiment Description: 

Mvp1 and Mvp2/3 knock-down
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

UN53_5145, UN52_5383
LsMvp1, LsMvp2/3

Target type: 

UN53_5145
UN52_5383
Fragment description

Fragment length: 

576bp

Fragment concentration: 

600ng/ul

Sense sequence: 

>F169 cacatggagacgaagaagtgcgattggagagagatccgtttccattatatccaggagaagagttaaaggtcaaggtcacaccattggcaatcgttcatacctcaaatgcccttttattaaaagttataagaaatttcacggacgaaaatgatgttaaacgtgtggctggagatttatttttgtttgagggacctggaacttatattccaaggaaagaggtcgaggttcttaaaaccattacagcacaagttatccatgaaaatgaagcccttaaattaagtgcaagtcgtgaaaccatagatcgatccggaattaaacacgttgcaggtgaagaatggctcataagaaagcctggagcttatttgcctttggcttatgaaaatattgtggaagttgttaaggcacatataccccttccagatgtcgcaattttggtaagagcaaaggcaactttcaaggacaagtttggtgttgagagaaaaaatggagacaaatacttgattacctttgaagatacatcagcattcattcctgaggtacaagaagaaataattggcacagtggatgctatcacac >F168 cctcccacccgaatggtcgtaatacctccaggatcttattgtgttgtatcaaaccctgttgtaacaaaagatggtactattgagaaagatcgctttggccaaattaagttatctcatggagatgaagaaattcgattaaaaagagatccttttccattatatccaggagagaaattgaaagttgaagtgacgcctttaacaatcgtacattcatcaagtgcacttcttttaaaagttatcagaaattttactgatgaagacaaaactgagcgtsttgctggagatttatacttgttcgaaggtccaggaacttattttcctagaaaagaggtggaagttgttaaaactattactgctacagtcatacatgagaatgaagctttaaaactgagtgctgctcgtgaaactttagacagatctggttgtaagagagtggcaggggagg

Fragment Label ID: 

F364

Fragment Mixture Formula: 

F169+F168

Primer Group: 

likb2502_T7_b2515

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

15

Phenotype: 

normal
Upload

Image file: 

Image Quality: 

0
No votes yet

Knock-down of all MVP. No visible phenotype.

AR F385 EMLSAT00000007048

Phenotype CV: 

General

Experiment Batch ID: 

RNAiAR

Experiment Contact: 

Start Date: 

16 August, 2018 - 09:00

End Date: 

20 September, 2018 - 09:00

Experiment Description: 

Knock-down of EMLSAG00000007048
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

EMLSAG00000007048
Fragment description

Fragment concentration: 

600ng/ul

Fragment Label ID: 

F385

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

12

Phenotype: 

No visible phenotype
Upload

Image file: 

Image Quality: 

0
No votes yet

RNAi with EMLSAT00000007048

AR F249 EMLSAT00000010968

Phenotype CV: 

General

Experiment Batch ID: 

RNAiAR

Experiment Contact: 

Start Date: 

16 August, 2018 - 09:00

End Date: 

20 September, 2018 - 09:00

Experiment Description: 

Knock-down of EMLSAG00000010968
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

EMLSAG00000010968
Fragment description

Fragment concentration: 

600ng/ul

Fragment Label ID: 

F249

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

11

Phenotype: 

No visible phenotype
Upload

Image file: 

Image Quality: 

0
No votes yet

RNAi of EMLSAT00000010968

Pages

Subscribe to RSS - no visible phenotype