no visible phenotype

LsHSCARB on free living stages

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

26 July, 2016 - 09:55

End Date: 

2 August, 2016 - 10:00

Experiment Description: 

Knock-down evaluation of primers




Number of Individuals (Start): 


Developmental Stage CV: 

Nauplius I
Target description
Fragment description

Fragment length: 


Fragment concentration: 


Sense sequence: 


Fragment Label ID: 


Efficacy of Knock Down: 


Number of Individuals (End): 




Image Quality: 

No votes yet

Testing the efficiency of RNAi fragment in freeliving stages. Non-parasitic stage is not feeding and therefore no phenotype was expected.

Rhabdovirus - No9+127 prod of virus free strain

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

16 January, 2017 - 14:11

Experiment Description: 

Test if it is possible to cure lice for two rhabdovirus simultaneously. Used lice taken from Hardanger fjord that was infected with both LsRV-No9 and No127 strains. Treatment given at Nauplius I and pre-adult stage. Copepods (80/fish) were given to 6 fish, and sampled at 25 days post infestation. Pre-adult lice were given 600 ng/ul dsRNA by injection and sampled at 55 dpi.




Number of Individuals (Start): 


Developmental Stage CV: 

Nauplius I
Target description
Fragment description

Fragment length: 


Fragment concentration: 


Sense sequence: 

No9: ttctcccggaccgacatggaaacagagtttcatgttaatctatccaagcccggtattcaatcacaatatccatctgagtggttttctgctggaaacaaaaggcccagtgtgtccgtgaaggtcccaacaacgtatctgaaaaaggagtcaagagattacttttgtaatctcctaaacaactcattgacagtccccgaatggtcaacgatccaagggatggtctggctctcggagatgtatcctagtcaactgaaggggaatgatgtactagagtcattcgggataaagttaactgatgataaaaaccaggtgacggtcaaatcaattcttaactatgccgaggtagaggatcccactactacactcaaacccccagccaacaacaaaacagaatggactgaccaggagtactttgtcgggattacggcagtactggtcagttaccggtatcacagacttgtgcacgaggaggggagggaggccttactgagaagattagccggaatgctgacatctcaaacgctaagccttgcgtctattgttcggaaagccctcccagaacccggcgaagacatgaggaaggttatggcagcgctagatctccagttcaaccttggagatgggaaccccgaattcaaaagagtcaggatggggacagttcatctgcttcagagggatcagacatttctaagtgaagttcttgccatatctggttggtttgggaccgagtcctatgaaatgatcaaatggattttctctgccgaggtagcgaaggaggtcagagatagattttctcatgcagacgaggaagcaggacaacaattttcttactctgcctatatgattgatttcgggatttccaacagatctccttactcagtcaccgccaatccctt No127: ggagccatcggaggttatgacctgggtgactcttgattccgtctcgactgagatcttgaagaccgtcagagatactgaggaaatttattgtcctttctcttatgccccctatatgatggatctcgggatatcagctaagtctccgtattcggtcacagaaaatcctttgtctcacctatggattcatgtgacaggagtaatattaaataacccgcgatctatgaatgcccggattatcggggagaccacatttcatcaggtaattttgtcctccgccctcctggcttatcggtgcgcaacaagtcctttattgagtcaaaagttcagtggacaatccgacctcagaggggtagaagagagtattagggtcttgtcggagtcaagttcatatttctcaaacactgaggatcttgatctggaagacgatccacaacaaaacactcccatggcatacgtcgcttggtgtgacaacaagtggaaccgtcgactttttacatttgtagactccgcaatgctaggattgacacggcccctt

Fragment Label ID: 


Fragment Mixture Formula: 


Fragment Producer: 

Aina-Cathrine Øvergård

Fragment Producer Contact: 


Efficacy of Knock Down: 


Image Quality: 

No votes yet


Rhabdovirus - No9+127 prod of virus free strain

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

16 January, 2017 - 14:11

Experiment Description: 

Test if it is possible to cure lice for two rhabdovirus simultaneously. Used lice taken from Hardanger fjord that was infected with both LsRV-No9 and No127 strains. Treatment given at Nauplius I and pre-adult stage. Copepods (80/fish) were given to 6 fish, and sampled at 25 days post infestation. Pre-adult lice were given 600 ng/ul dsRNA by injection and sampled at 75 dpi. The offspring of these females were treated with dsRNA at Nauplius I and pre-adult stage as described above, and adult lice were sampled at 55 dpi.




Number of Individuals (Start): 


Developmental Stage CV: 

Nauplius I
Target description
Fragment description

Fragment length: 


Fragment concentration: 


Sense sequence: 

>No9: ttctcccggaccgacatggaaacagagtttcatgttaatctatccaagcccggtattcaatcacaatatccatctgagtggttttctgctggaaacaaaaggcccagtgtgtccgtgaaggtcccaacaacgtatctgaaaaaggagtcaagagattacttttgtaatctcctaaacaactcattgacagtccccgaatggtcaacgatccaagggatggtctggctctcggagatgtatcctagtcaactgaaggggaatgatgtactagagtcattcgggataaagttaactgatgataaaaaccaggtgacggtcaaatcaattcttaactatgccgaggtagaggatcccactactacactcaaacccccagccaacaacaaaacagaatggactgaccaggagtactttgtcgggattacggcagtactggtcagttaccggtatcacagacttgtgcacgaggaggggagggaggccttactgagaagattagccggaatgctgacatctcaaacgctaagccttgcgtctattgttcggaaagccctcccagaacccggcgaagacatgaggaaggttatggcagcgctagatctccagttcaaccttggagatgggaaccccgaattcaaaagagtcaggatggggacagttcatctgcttcagagggatcagacatttctaagtgaagttcttgccatatctggttggtttgggaccgagtcctatgaaatgatcaaatggattttctctgccgaggtagcgaaggaggtcagagatagattttctcatgcagacgaggaagcaggacaacaattttcttactctgcctatatgattgatttcgggatttccaacagatctccttactcagtcaccgccaatccctt >No127: ggagccatcggaggttatgacctgggtgactcttgattccgtctcgactgagatcttgaagaccgtcagagatactgaggaaatttattgtcctttctcttatgccccctatatgatggatctcgggatatcagctaagtctccgtattcggtcacagaaaatcctttgtctcacctatggattcatgtgacaggagtaatattaaataacccgcgatctatgaatgcccggattatcggggagaccacatttcatcaggtaattttgtcctccgccctcctggcttatcggtgcgcaacaagtcctttattgagtcaaaagttcagtggacaatccgacctcagaggggtagaagagagtattagggtcttgtcggagtcaagttcatatttctcaaacactgaggatcttgatctggaagacgatccacaacaaaacactcccatggcatacgtcgcttggtgtgacaacaagtggaaccgtcgactttttacatttgtagactccgcaatgctaggattgacacggcccctt

Fragment Label ID: 


Fragment Mixture Formula: 


Fragment Producer: 

Aina-Cathrine Øvergård

Fragment Producer Contact: 


Efficacy of Knock Down: 


Image Quality: 

No votes yet


NAH F186

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

21 November, 2014 (All day)

End Date: 

12 January, 2015 (All day)




Number of Individuals (Start): 


Developmental Stage CV: 

Nauplius I
Target description

Primary target ID: 

Gene or target symbol: 

Fragment description

Fragment length: 


Fragment concentration: 


Fragment Label ID: 


Primer Group: 


Fragment Producer: 


Fragment Producer Contact: 


Number of Individuals (End): 


Image file: 

Gallery Image: 

Image Quality: 

No votes yet

RNAi knockdown in nauplii of genes involved in iron or heme uptake, transport, storage or homeostasis, and with elevated expression from the parasitic copepodid stage. Infection of fish with knockdown copepodids (3 fish with 80 lice) and lice count after 16 and 42 days. No significant difference in number of lice on fish at termination. qPCR validation not done yet.

NAH F154

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

21 November, 2014 (All day)

End Date: 

12 January, 2015 (All day)




Number of Individuals (Start): 


Developmental Stage CV: 

Nauplius I
Target description
Fragment description

Fragment length: 


Fragment concentration: 


Fragment Label ID: 


Primer Group: 


Fragment Producer: 


Fragment Producer Contact: 


Number of Individuals (End): 


Image file: 

Gallery Image: 

Image Quality: 

No votes yet

RNAi knockdown in nauplii of genes involved in iron or heme uptake, transport, storage or homeostasis, and with elevated expression from the parasitic copepodid stage. Infection of fish with knockdown copepodids (3 fish with 80 lice) and lice count after 16 and 42 days. No significant difference in number of lice on fish at termination. qPCR validation not done yet.

NAH F135

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

21 November, 2014 (All day)

End Date: 

12 January, 2015 (All day)




Number of Individuals (Start): 


Developmental Stage CV: 

Nauplius I
Target description
Fragment description

Fragment length: 


Fragment concentration: 


Fragment Label ID: 


Primer Group: 


Fragment Producer: 


Fragment Producer Contact: 


Number of Individuals (End): 


Image file: 

Gallery Image: 

Image Quality: 

No votes yet

RNAi knockdown in nauplii of genes involved in iron or heme uptake, transport, storage or homeostasis, and with elevated expression from the parasitic copepodid stage. Infection of fish with knockdown copepodids (3 fish with 80 lice) and lice count after 16 and 42 days. No significant difference in number of lice on fish at termination. qPCR validation not done yet.


Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

21 November, 2014 (All day)

End Date: 

12 January, 2015 (All day)




Number of Individuals (Start): 


Developmental Stage CV: 

Nauplius I
Target description

Primary target ID: 

Gene or target symbol: 

CPY 185
Fragment description

Fragment concentration: 


Fragment Label ID: 


Primer Group: 


Number of Individuals (End): 


Image file: 

Gallery Image: 

Image Quality: 

No votes yet

RNAi knockdown in nauplii of genes involved in iron or heme uptake, transport, storage or homeostasis, and with elevated expression from the parasitic copepodid stage. Infection of fish with knockdown copepodids (3 fish with 80 lice) and lice count after 16 and 42 days. One fish died 18.12.2014 -> results missing. No significant difference in number of lice on fish at termination. qPCR validation not done yet.

S F186 (FLVCR2)

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

14 October, 2014 - 11:05

End Date: 

14 November, 2014 (All day)




Number of Individuals (Start): 


Developmental Stage CV: 

Target description

Primary target ID: 

Gene or target symbol: 

Fragment description

Fragment length: 


Fragment concentration: 


Fragment Label ID: 


Primer Group: 


Fragment Producer: 


Fragment Producer Contact: 


Number of Individuals (End): 


Image Quality: 

No votes yet

RNAi with adult females. No visible phenotype. No hatching data from IMR. qPCR validation not done yet. Fotos (RS160-179, RFS28-30) at P:\Sealice\RNAi\RNAi_fotos_samplet\Experiment_S\RNAiS.

S F172 (FLVCR)

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

14 October, 2014 - 11:05

End Date: 

14 November, 2014 (All day)




Number of Individuals (Start): 


Developmental Stage CV: 

Target description
Fragment description

Fragment length: 


Fragment concentration: 


Fragment Label ID: 


Primer Group: 


Fragment Producer: 


Fragment Producer Contact: 


Number of Individuals (End): 


Image Quality: 

No votes yet

RNAi with adult females. No visible phenotype. No hatching data from IMR. qPCR validation not done yet. Fotos (RS18-38, RFS4-6) at P:\Sealice\RNAi\RNAi_fotos_samplet\Experiment_S\RNAiS.

R F171 (Fepo)

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

21 August, 2014 - 10:23

End Date: 

30 September, 2014 (All day)




Number of Individuals (Start): 


Developmental Stage CV: 

Target description

Primary target ID: 

Gene or target symbol: 

Fepo (Ferroportin)
Fragment description

Fragment length: 


Fragment concentration: 


Fragment Label ID: 


Primer Group: 


Fragment Producer: 


Fragment Producer Contact: 


Number of Individuals (End): 


Gallery Image: 

Image Quality: 

No votes yet

RNAi with preadult females. No visible phenotype. Hatching rate not determined yet, but looks no different from control. qPCR validation not done yet.


Subscribe to RSS - no visible phenotype