K F76

General

End Date: 

Monday, May 13, 2013 (All day)

Experiment Batch ID: 

K

Start Date: 

Wednesday, April 3, 2013 - 14:34

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

34

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

UN7_g423
LSalAtl2s685

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F76

Fragment concentration: 

433.00ng/ul

Fragment length: 

422bp

Sense sequence: 

gcctctttaggacatttgctgctaagatagagtagggagcttcatttgtgaggaacactttcaatctctcttttctaaaattggagcccaaagcgcggagaaggctagtcacagcaacttcttgaatggtgctacagttggcgttaacgacattgcagagattaatgaggtaaggggtacctgaaaaggtttcatccagtggaccaatcaatactgcaattaaagatcgatccttgatatccgtcgtctcgtccagtgtcatgaaaatatcccttccgtcaatttcgtcgctgatcttggaaagcatggactcactttccactttcaaggactgagtgatggcgtagcgggaaggaagggaccttccagtgtatttctggatgaagagggaaaagttgttgtattccacgatggagatggga

Fragment Producer: 

licelab

Primer Group: 

b1398
Phenotype

Phenotype CV: 

Phenotype: 

No visible phenotype

Number of Individuals (End): 

14

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

RNA i  completed RNA i completed RNA i completed RNA i completed