K F80

General

End Date: 

Monday, May 13, 2013 (All day)

Experiment Batch ID: 

k

Start Date: 

Wednesday, April 3, 2013 - 14:49

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

36

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

Thyro g12693

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F80

Fragment concentration: 

600.00ng/ul

Fragment length: 

436bp

Sense sequence: 

gcccaattaacggtattgactatggctataatcttgtaaacaataatgaaattgaggatttcaccattctaaatgcagtcccactaccggaaagtcctattccatccttaattgaggtaaaagaggaacccaagaaaagaaaacgacggccagagcccatgacggatgtttgcaggatatgtggggatattgcgccccctcataatcactacggtgcaattgcttgtttctcatgtagagctttcttcggaagaacagtgcataaaggaacccaggaaagatttcgctgtgtaagaggtaatccagatgaatccggacagtgtatgatcactaaagccacaagaacacattgtcagttttgtcgttatcgcggatgtctttctgccggaatgaaaccctcctatgtcacaactgccgaagagcgactgcaaaagaa

Fragment Producer: 

licelab

Primer Group: 

b1432
Phenotype

Phenotype CV: 

Number of Individuals (End): 

18

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Knockdown of 4174