J F75

General

End Date: 

Monday, April 8, 2013 (All day)

Experiment Batch ID: 

J F75

Start Date: 

Wednesday, February 27, 2013 - 08:18

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

UN4_g84

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F75

Fragment concentration: 

600.00ng/ul

Fragment length: 

584bp

Sense sequence: 

atgctttctagcaatgcttactggccttatatcccttctctatattccatctattctggaggttcttatcatcacaggaaattcatctacaccagatacagcctttgcaagatatttacgaacattgaaccatacctatgcatggttccatagtgaatcttctctaagtaaatcattgattcaagtacggaacgctcatatccgtgctgataaatcatcaagttccaaaaggaaaggacaattcatgagtcaatatgatatggttgtgactcaatgggcatttgtaggcctattatatactaaaccatcaaattttggattaaaaagtccctctaaatcgggtttagaggctctaagacgtcttatgtacaaagttggttatttcctgggtgtagaagataaatttaacctctgctatggctcagtggaaatgactcagtcctattccaaagacattagtgaatacattatcaaaccggctatagaggatcctcagtcatccgtcaaatctgatgaaatgaccaaaatattattgaaagggattcacatcatcaatccatttgtacttcctctcgcatttggca

Fragment Producer: 

licelab

Primer Group: 

b1373
Phenotype

Phenotype CV: 

Number of Individuals (End): 

11

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Fors√łk J startet 27 februar 2013

Knockdown of gene with unknown function.