L F101

General

End Date: 

Monday, June 10, 2013 (All day)

Experiment Batch ID: 

L F101

Start Date: 

Friday, April 26, 2013 - 09:54

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult
Adult

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F101

Fragment concentration: 

600.00ng/ul

Fragment length: 

434bp

Sense sequence: 

accactaccccggaccttgacagattcatttaatgaacgttgataatccagcatcgaggagtcgacctttgtctggtttaactttttttcttttgatgtcatgacatcaacttttgctgctaagccctggggatggactctttttcgccgtcttgcgtgctctttgaatatttaatttaactgaatccgtagttgtggatcttgcatgagggaatatattatcgactttattcctaaatgaatccaagataagtgactcgtacttatcaatcgtaaattttaaatcaattaaataaaggtcacggatgctatgcggaaacaatgtcgtattagaatcactattgttatatcgtaaacgatgcaactctcgttctgcaaaggcttgaaattgttccttgatttcttcagagaggacagaccatgcctgacaaca

Fragment Producer: 

licelab

Primer Group: 

b1627
Phenotype

Phenotype CV: 

Number of Individuals (End): 

12

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Normal looking animals, no obvious phenotype.

No Stable ID