P F108

General

End Date: 

Tuesday, April 22, 2014 (All day)

Experiment Batch ID: 

P

Start Date: 

Friday, March 7, 2014 - 15:55

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

UN27_g18393

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F108

Fragment concentration: 

600.00ng/ul

Fragment length: 

438bp

Sense sequence: 

gtcaacaagccatccgagccaaaatccttcgaaataaggacaaccgattgggccatgtgctgggaaatgtttctcgagacgaaatcaatactggaactggaaacgaggaacttgaacctgtgaggatgagggcaactccattacggagaatacaggacgaagcggtgactcctgtgcctctctccactcctcctccttcaatctttaatttatccgggaacaaccaggtggctcctggggttgaagctccaactgtaaatgagagactcatctgctgtggctggctcctctccggactcttgactcgactgctcctccatttctttcccaatctcaatgccttcatcattttctctatcactgccttttctgttcaaacactacgcctcattgacttaagggcttcttccaattccaatgtatcccttcttcgtctcg

Fragment Producer: 

licelab

Primer Group: 

UN27_g18393f_b1697
Phenotype

Phenotype CV: 

Number of Individuals (End): 

11

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

    no obvious phenotype              no obvious phenotype              no obvious phenotype              no obvious phenotype              no obvious phenotype