T F178

General

End Date: 

Tuesday, December 9, 2014 (All day)

Experiment Batch ID: 

T

Start Date: 

Thursday, October 30, 2014 - 13:10

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

28

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F178

Fragment concentration: 

600.00ng/ul

Fragment length: 

537bp

Sense sequence: 

attgcaaagtttatctccggcacaataaaacggtttcttggttacgacatggagccaaaaattcattggagcttttaacagtaggagattcaacctatactggcgattctcgtatcaatgtttcatacaaatatcctaataattatcgtttgaatattacaaatgtaaaaaaatctgatgctggacgttatgtgtgtcaaatatctacctttccgccgaagggactctttacatatctaaaagttgaagaygctcttttagagttgattgattctaactatgaagcaatgatggagcaattttataatcctggttctgaaatagctcttacctgtattattcgaagtcgtgaagattgggcaacagatgtaatcatcggaatgcaagttgaagcagaacacgttctaagtcgcctctggatacgtgaagcaagtctttcagattctggaaattattcctgtattatacaacgaaaagaaaatatacaattccctagagcaaaggttaatgtacatgttgttgaaggaaatcttcatg

Fragment Producer: 

licelab

Primer Group: 

likb2831_T7_b2853
Validation

Efficacy of Knock Down: 

F>0.00%
Phenotype

Phenotype: 

A few slightly abnormal

Number of Individuals (End): 

14

Gallery Image: 

Upload

Image Quality: 

0
No votes yet

Et av Gunvørs fragmenter