R F125

General

End Date: 

Tuesday, September 30, 2014 (All day)

Experiment Batch ID: 

R

Start Date: 

Thursday, August 21, 2014 - 08:32

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

39

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F125

Fragment concentration: 

600.00ng/ul

Fragment length: 

454bp

Sense sequence: 

actttgtttctccctacgcgtggatttctgataatggaggcgaggaaatttggactttcctagcagaagaagataacataatgtgtcggatatgtcgttataagtgcccatttagccctccttctagaatgaaacggcacttagcatgccctacccatatcaggaatgttgagttattcagaaaacatgtaattcacgaggacatagactccggaaacttcaatacagacctcacaaagatgctcgtttcgtgtaacatacccctagccaccgtcgatcaccctaatttcaagaagttcttggagaaatatgttggtaagtccgttccaagtcgaaagtccacgattagattggttggagaagttagtaaggatgtcatctgcaaagttaaggaggaagttgagggtaaagatatcttcatagctgtagatgagaccaaggacaatcgagatcg

Fragment Producer: 

licelab

Primer Group: 

b1891
Phenotype

Phenotype CV: 

Number of Individuals (End): 

18

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Downregulation of gene with unknown function