Z F197

General

End Date: 

Thursday, October 1, 2015 (All day)

Experiment Batch ID: 

Z

Start Date: 

Thursday, August 27, 2015 - 13:44

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F197

Fragment concentration: 

429.00ng/ul

Fragment length: 

742bp

Sense sequence: 

tggaacgcagtgtcagtgatctcattgggataaccccactaatatagcagcataaaacaccattgcccctcaggcttacgatgaattggtaaagcttgataagtgggccttctgaatgtgcatcgagatgtatcatctgcagaaaaggcttgcttcgaagatgttcaaagacttgtagaaacataaacaagagctctcgtggaagagggcaccactagaaactgaatgtaaaaagtacccggatcgtttacagtggtcgccaataagagtaatgaatagcgttccgattgaatcccgaagagcatatgggctaggcttaggggctccaatcgaaggaaatgagctgatgaccatatatctacctgaaaaatatttttgggttagtgacagtagaagatgtgttaaatgcaagagggttcatcctctatcattgatgctgaagaatcaactccaacc

Fragment Producer: 

licelab

Primer Group: 

b3250
Phenotype

Phenotype CV: 

Number of Individuals (End): 

26

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Unknown function of gene-

No validation of knockdown.