AC F230

General

End Date: 

Monday, January 25, 2016 - 14:23

Experiment Description: 

Experiment Batch ID: 

AC

Start Date: 

Monday, December 14, 2015 - 14:23

Experiment Contact: 

Sample

Developmental Stage CV: 

Adult

Number of Individuals (Start): 

31

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

504

Target type: 

Primary target ID: 

Fragment description

Antisense sequence: 

Fragment Label ID: 

F230

Fragment Batch ID: 

Fragment ID: 

Fragment length: 

192bp

Sense sequence: 

gaacaacgcaatctggacaagtgaaaaagagatgtttcggacgtagaccaagaccaagaccatcagcaaatcttagtgttaaggacttgatggatttaataaaaatgattatggaacttgcaaaaaagaaaggtgctgagaaaagaaatattgtttcaagtccaactatgactcatgttaaagtactctccg

Fragment Mixture Formula: 

Fragment Producer: 

Primer Group: 

Phenotype

Phenotype: 

Number of Individuals (End): 

24
Upload

Image Quality: 

0
No votes yet

hkh kjhkh khkh lkjhkjh kh khkh khkh   kkhhkhh lkjh