AI F316

General

End Date: 

Tuesday, February 21, 2017 - 10:30

Experiment Batch ID: 

AI

Start Date: 

Monday, January 16, 2017 - 13:06

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

EMLSAT00000006642

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Antisense sequence: 

ctactcaaaagtgccgatgtgctggaattgcaccgccaccagcaccagcccctgcaccagcgcctgcaccagcgcctgcacccgcccctgcaccagcccctgcaccagcgcctgcacctgcaccagcacctgcaccagcgcctgcaccagcaccaaagggaggaagaagaagaagagacgtacccatcg

Fragment Label ID: 

F316

Fragment Batch ID: 

1

Fragment concentration: 

600.00ng/ul

Fragment length: 

421bp

Fragment Producer: 

Liv Sandlund
Validation

Efficacy of Knock Down: 

F>97.00%
Phenotype

Number of Individuals (End): 

10

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

s