Submitted by Aina-Cathrine Ø... on 23 March, 2017 - 13:32 GeneralEnd Date: Tuesday, February 21, 2017 - 10:30Experiment Batch ID: AIStart Date: Monday, January 16, 2017 - 13:06Experiment Contact: Aina-Cathrine ØvergårdLiv Sandlund SampleDevelopmental Stage CV: PreAdult2AdultNumber of Individuals (Start): 30Sex: femaleOrganism: Lepeophtheirus salmonis Target descriptionGene or target symbol: EMLSAT00000006642Primary target ID: EMLSAT00000006642, EMLSAT00000006642-702489 (mRNA) Lepeophtheirus salmonis Fragment descriptionFragment Producer Contact: Liv SandlundAntisense sequence: ctactcaaaagtgccgatgtgctggaattgcaccgccaccagcaccagcccctgcaccagcgcctgcaccagcgcctgcacccgcccctgcaccagcccctgcaccagcgcctgcacctgcaccagcacctgcaccagcgcctgcaccagcaccaaagggaggaagaagaagaagagacgtacccatcgFragment Label ID: F316Fragment Batch ID: 1Fragment concentration: 600.00ng/ulFragment length: 421bpFragment Producer: Liv Sandlund ValidationEfficacy of Knock Down: F>97.00% PhenotypeNumber of Individuals (End): 10Gallery Image: Image file: RAI37.tif UploadImage Quality: 0 No votes yet s Log in to post comments