Submitted by Aina-Cathrine Ø... on 4 December, 2017 - 10:28 GeneralEnd Date: Monday, August 21, 2017 - 10:09Experiment Description: Salmon at 12 degrees were infested in single tanks with 70 knock-down cops/fish. Sampling at 3 and 6 days post infestation. Immun gene response were measured in salmon skin at attachment site. Experiment Batch ID: ExpCStart Date: Tuesday, August 15, 2017 - 10:05Experiment Contact: Aina-Cathrine Øvergård SampleDevelopmental Stage CV: CopepodidNumber of Individuals (Start): 420Sex: bothOrganism: Lepeophtheirus salmonis Target descriptionPrimary target ID: EMLSAT00000006642, EMLSAT00000006642-702489 (mRNA) Lepeophtheirus salmonis Fragment descriptionFragment Producer Contact: Aina-Cathrine ØvergårdAntisense sequence: ctactcaaaagtgccgatgtgctggaattgcaccgccaccagcaccagcccctgcaccagcgcctgcaccagcgcctgcacccgcccctgcaccagcccctgcaccagcgcctgcacctgcaccagcacctgcaccagcgcctgcaccagcaccaaagggaggaagaagaagaagagacgtacccatcgFragment Label ID: F6642Fragment concentration: 4000.00ng/ulFragment length: 189bpFragment Producer: Aina-Cathrine Øvergård ValidationEfficacy of Knock Down: F>86.00% PhenotypeNumber of Individuals (End): 66 UploadImage Quality: 0 No votes yet påiåp Log in to post comments