G F48

General

End Date: 

Tuesday, January 29, 2013 - 10:06

Experiment Batch ID: 

G

Start Date: 

Thursday, December 20, 2012 - 10:57

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

36

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

g37265

Primary target ID: 

Fragment description

Fragment Label ID: 

F48

Fragment Batch ID: 

G

Fragment concentration: 

600.00ng/ul

Fragment length: 

593bp

Sense sequence: 

tcaagaaaatgtttggcctgccattgatgatctccgattggttaaaccatttatatctgaatcaacatcacaatttaatttgattaatgaagaaatagaagttttgaagaaaataacagataattctactaatgaaatctccaataagatttggcccaaaatcacacaaataagcgttgagcaaaatgagcaagtctctgtaaacatccaaaatattgagaacaagtttaacattgaaatcaatgacaaattatggccttatgttcaagaaatgaatactttcttgaaagacgaagtagaaggtaaattgataccacatgttcaagaattggatgatttgagacctcagctcaatgatgttagggagacagttaaggatgtcaatgctaaggcagaaaaatctcttgatgaaattttcaactctctttggcctcatgtcaagagtttgaatatcaaattatctgatgatatcattcaaaatattaagaatcttgaaattaagtttgacaccgaaatttttaagaaaatgtggccatttattaatgatatggaccgagatattaaaaaggagatacatgaaggtatgtggccca
Phenotype

Phenotype: 

No visible phenotype

Number of Individuals (End): 

10
Upload

Image Quality: 

0
No votes yet

Old Experiment.
Primers don't match 5311.