AP F352

General

End Date: 

Tuesday, April 10, 2018 - 10:54

Experiment Batch ID: 

AP

Start Date: 

Wednesday, March 7, 2018 - 13:26

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

4874 Var2_1

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F352

Fragment concentration: 

600.00ng/ul

Fragment length: 

322bp

Sense sequence: 

tcaagcgacgaggaattattgctactcaaggaagaaaattcttacttaatgaagagtacgctgactgatgatggaaaagaactccttcccaaagatggtaaaggtagttttgtgggaggagacgctagagctcttctaaccactggtttggcttcagttcataccttattcgttcgggaacataatcgaatatcaaggaaacttgctcagatgaatccttcatacacaaacgaaactgtttttcaagaaactcggcgaatattgggagcaatgatgcaaaatattgtttatagtgaatttcttccgacgttattaggggaaa
Validation

Efficacy of Knock Down: 

F>80.00%
Phenotype

Phenotype CV: 

Number of Individuals (End): 

20

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Downregulation of 4874 Var 2_1