AQ F372 EMLSAG00000011562

General

End Date: 

Wednesday, May 23, 2018 - 09:00

Experiment Description: 

Knock-down of EMLSAG00000011562

Experiment Batch ID: 

RAQ

Start Date: 

Monday, April 16, 2018 - 09:00

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

EMLSAG00000011562

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F372

Fragment concentration: 

600.00ng/ul

Fragment length: 

405bp

Sense sequence: 

ggttgcaggaaatgaagaagaggcatggattgagatttggaatctacgaggaggagctcctttctttcagcgttggcttccaackggaraatcctctctagaggctattgcattcggagccaaaggacgaatgtactccacgggtttgcacggatatatcctgtcacatgacattcagtctggagcagtatcaaagtcgcctgtgagttggggtgcttcatggtgcttggattatcatcctttgagcaagaggatcgcagttggtacggaagaaggtgttgtgtgcatattcagagaagagtcttcaggcgagattgtctatgaaaagtcacttgataaacaagaaggtcgaatcctatctcttgcttgggaacctctttctggagataagatggtaacgggctc

Fragment Producer: 

licelab
Phenotype

Phenotype CV: 

Phenotype: 

No visible phenotype

Number of Individuals (End): 

13

Image file: 

Upload

Image Quality: 

0
No votes yet

Knock-down of EMLSAT00000011562