EMLSAT00000009839_Var1Frag1

General

End Date: 

Tuesday, July 4, 2017 - 11:47

Experiment Description: 

Fish infested With KD copepodides

Experiment Batch ID: 

Exp1

Start Date: 

Friday, June 9, 2017 - 11:17

Experiment Contact: 

Sample

Developmental Stage CV: 

Copepodid
PreAdult

Number of Individuals (Start): 

60

Sex: 

both

Organism: 

Target description

Gene or target symbol: 

Heme peroxidase

Target type: 

mRNA

Primary target ID: 

Fragment description

Fragment Label ID: 

9839Fragment1

Fragment concentration: 

10.00ng/ul

Fragment length: 

429bp

Sense sequence: 

acctggtcagcaacgacttggcccacgagagcaagttaaccaaaatacggctttcattgatgcatctatgatttatgggaatgacaaatgtgactctattgatttacgacaaaacatcgatggtaggctgaacactacactacccagtcatggaagaggcaaacatcttatgcccaaggatagttccaataaggaatgtaaagcggcttcaggattttgtttcaaaggaggagatgctagagcctctgagcagcctggacttgctgctttacatactatttttctcagggaacataatcgtctcgtcaccaagctgaaaagagtcaatcctcattggagtgatgacgaactttattatgagggaaggcatattttatcagctgtgaatcaacacatcacttataatgagttccttcctcggatcattgg
Phenotype

Phenotype CV: 

Number of Individuals (End): 

5
Upload

Image Quality: 

0
No votes yet

Testing function of vaccine candidate gene from Oslo in cooperation with Elisabeth Gislefoss!