reduced

Functional characterization of a heme Peroxidase (male) F159

Phenotype CV: 

General

Experiment Batch ID: 

Exp 1

Experiment Contact: 

Start Date: 

30 May, 2014 - 12:30

End Date: 

10 June, 2014 - 12:33

Experiment Description: 

Female and male padI/padII lice were injected. Samples were taken at 6 and 10 days post injection.
Sample

Organism: 

Sex: 

Male

Number of Individuals (Start): 

42

Developmental Stage CV: 

padII/ad
Adult
Target description
Fragment description

Fragment length: 

936bp

Fragment concentration: 

600ng/ul

Sense sequence: 

acttgcattacctatgaggcagtcaatgctgcatttaccactgccttagaaagagtaggacttccacctgtaaggggaaagttcactactgatgatgtgggtaatcttggaactgtgattcatgaaacgagtcgttaccttgccaaacagtatggcctatctaaagatgctatttctaatggactacctctcattgatactactaagaccatcattgaaggctactgtccaccctttttgatgactccaaagtgcacagtggagcgttacagaagtgttaacggaatgtgtaacaacgtagagcaccctcattggggagcggctatgaatggacatcacagattccttgcacctaattttgcagatggaatctctgctccaagggcctccaaaactggaaatcctcttccttctgctcgtattgtttcatctaatatgcacagagatgaaggattccacgatcatgctgtgactattcttctcgtagcctggggacagtttattgatcacgatatcactcttagtgctgaaacaaaggatcctcgtacagggaaaacacccaagtgttgtgaagagggacaaactgctgttcatcccaattgcttgccaatcgaaatcccatctcatgatacattcttctcaaaacacaagcaacgttgtatgaactttgttcgttctcaagccggtcttcgttacaattgcagactaggaccccgtgataccttcaatgaagtatcatccctcctagatgctggaaccgtgtactccaactctgatgagactcttgagagtttgagactctacaaggacggactccttaaaatgttgcccgtttttaatgaatttgaaatgaaggaactccttcctcttaaattggaatctcctgatgagggttgcattagaccttcagaagatgtgtattgtttcttggctgga

Fragment Label ID: 

F159

Fragment Producer: 

Aina-Cathrine Øvergård
Validation

Efficacy of Knock Down: 

F>98%
Phenotype

Number of Individuals (End): 

1

Phenotype: 

Fall off the fish
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

Heme peroxidases are the most abundant type of peroxidase catalyzing a H2O2-dependent oxidation of a wide variety of substrates. They are involved in numerous processes like the innate immune response, hormone and prostaglandin synthesis and crosslinking of proteins within extracellular matrixes (ECM) as well as molecules within the cuticle and chorion of arthropods and nematodes. In the present study, a Lepeophtheirus salmonis heme peroxidase (LsHPX) 1 was characterized.

Functional characterization of a heme Peroxidase (female) F159

Phenotype CV: 

General

Experiment Batch ID: 

Exp 1

Experiment Contact: 

Start Date: 

30 May, 2014 - 12:30

End Date: 

10 June, 2014 - 12:33

Experiment Description: 

Female and male padI/padII lice were injected. Samples were taken at 6 and 10 days post injection.
Sample

Organism: 

Sex: 

Female

Number of Individuals (Start): 

42

Developmental Stage CV: 

PreAdult1
PreAdult2/Adult
Target description
Fragment description

Fragment length: 

936bp

Fragment concentration: 

600ng/ul

Sense sequence: 

acttgcattacctatgaggcagtcaatgctgcatttaccactgccttagaaagagtaggacttccacctgtaaggggaaagttcactactgatgatgtgggtaatcttggaactgtgattcatgaaacgagtcgttaccttgccaaacagtatggcctatctaaagatgctatttctaatggactacctctcattgatactactaagaccatcattgaaggctactgtccaccctttttgatgactccaaagtgcacagtggagcgttacagaagtgttaacggaatgtgtaacaacgtagagcaccctcattggggagcggctatgaatggacatcacagattccttgcacctaattttgcagatggaatctctgctccaagggcctccaaaactggaaatcctcttccttctgctcgtattgtttcatctaatatgcacagagatgaaggattccacgatcatgctgtgactattcttctcgtagcctggggacagtttattgatcacgatatcactcttagtgctgaaacaaaggatcctcgtacagggaaaacacccaagtgttgtgaagagggacaaactgctgttcatcccaattgcttgccaatcgaaatcccatctcatgatacattcttctcaaaacacaagcaacgttgtatgaactttgttcgttctcaagccggtcttcgttacaattgcagactaggaccccgtgataccttcaatgaagtatcatccctcctagatgctggaaccgtgtactccaactctgatgagactcttgagagtttgagactctacaaggacggactccttaaaatgttgcccgtttttaatgaatttgaaatgaaggaactccttcctcttaaattggaatctcctgatgagggttgcattagaccttcagaagatgtgtattgtttcttggctgga

Fragment Label ID: 

F159

Fragment Producer: 

Aina-Cathrine Øvergård
Validation

Efficacy of Knock Down: 

F>78%
Phenotype

Number of Individuals (End): 

0

Phenotype: 

Fall off the fish
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

Heme peroxidases are the most abundant type of peroxidase catalyzing a H2O2-dependent oxidation of a wide variety of substrates. They are involved in numerous processes like the innate immune response, hormone and prostaglandin synthesis and crosslinking of proteins within extracellular matrixes (ECM) as well as molecules within the cuticle and chorion of arthropods and nematodes. In the present study, a Lepeophtheirus salmonis heme peroxidase (LsHPX) 1 was characterized.

C F4 (CopB2)

Phenotype CV: 

General

Experiment Batch ID: 

C

Experiment Contact: 

Start Date: 

14 August, 2012 - 09:00

End Date: 

24 September, 2012 - 09:00
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

LsCopB2
Fragment description

Fragment length: 

566bp

Fragment concentration: 

600ng/ul

Sense sequence: 

atcgtgtcaagtccacagacctgcacccagtggagccttggatgttggcctcgctctacaacgggaacgtgcacatttggaactacgagtctcagcagttggtcaagtccctggaggtgtgcgacttgccggtgcgagccgccaagtttgtgagccgtaagaattgggtggtgacgggttctgacgacatgaagctgaatgtgttcaactacaacaccctggagcgtgtgtcttgcctggaggcgcactctgactatctgcggtccctggccgtccacccgagtgagcccctggtcctctcctcctcggacgacatgctcattaagctctggaactgggacaaggcctgggcctgtgaacaggtcttcgagggacacacgcactacataatgcaagtggtcatcaaccccaaggacaacaacacttttgcctccgcctctttggaccgcaccatcaaggtctggcacttgggcgcatcttgccccaacttcactctggagggacatgacaagggcgtcaactgtctggactactaccacgccggggacaagccctacctcatctcg

Fragment Label ID: 

F4

Primer Group: 

b671

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>82%
Phenotype

Number of Individuals (End): 

0
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of LsCopB2 in preadult female lice. Early termination after 15 days (Rack 4a and 4b - no survivors in 4c at normal termination date). High mortality, empty gut, no egg strings, underdeveloped genital segment and abdomen.

A F4 (CopB2)

Phenotype CV: 

General

Experiment Batch ID: 

A

Experiment Contact: 

Start Date: 

23 January, 2012 - 09:00

End Date: 

24 February, 2012 - 09:00
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

LsCopB2
Fragment description

Fragment length: 

566bp

Fragment concentration: 

600ng/ul

Sense sequence: 

atcgtgtcaagtccacagacctgcacccagtggagccttggatgttggcctcgctctacaacgggaacgtgcacatttggaactacgagtctcagcagttggtcaagtccctggaggtgtgcgacttgccggtgcgagccgccaagtttgtgagccgtaagaattgggtggtgacgggttctgacgacatgaagctgaatgtgttcaactacaacaccctggagcgtgtgtcttgcctggaggcgcactctgactatctgcggtccctggccgtccacccgagtgagcccctggtcctctcctcctcggacgacatgctcattaagctctggaactgggacaaggcctgggcctgtgaacaggtcttcgagggacacacgcactacataatgcaagtggtcatcaaccccaaggacaacaacacttttgcctccgcctctttggaccgcaccatcaaggtctggcacttgggcgcatcttgccccaacttcactctggagggacatgacaagggcgtcaactgtctggactactaccacgccggggacaagccctacctcatctcg

Fragment Label ID: 

F4

Primer Group: 

b671

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>65%
Phenotype

Number of Individuals (End): 

5
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of LsCopB2 in preadult female lice. High mortality, empty gut, no egg strings, underdeveloped genital segment and abdomen.

Q F123

Phenotype CV: 

General

Experiment Batch ID: 

Q

Experiment Contact: 

Start Date: 

10 June, 2014 - 13:35

End Date: 

22 April, 2014 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

40

Developmental Stage CV: 

PreAdult2
Adult
Target description
Fragment description

Fragment length: 

408bp

Fragment concentration: 

600ng/ul

Fragment Label ID: 

F123

Primer Group: 

b1881

Fragment Producer: 

Licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>10%
Phenotype

Number of Individuals (End): 

13

Phenotype: 

Reduced survival
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Downregulation of gene with unknown function

Q F122

Phenotype CV: 

General

Experiment Batch ID: 

Q

Experiment Contact: 

Start Date: 

10 June, 2014 - 13:35

End Date: 

22 April, 2014 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

UN30_g17511
Fragment description

Fragment length: 

370bp

Fragment concentration: 

600ng/ul

Fragment Label ID: 

F122

Primer Group: 

b1879

Fragment Producer: 

Licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>30%
Phenotype

Number of Individuals (End): 

16

Phenotype: 

Reduced survival
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

No image no image no image no image no image

Q F121

Phenotype CV: 

General

Experiment Batch ID: 

Q

Experiment Contact: 

Start Date: 

10 June, 2014 - 13:35

End Date: 

22 April, 2014 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description
Fragment description

Fragment length: 

545bp

Fragment concentration: 

600ng/ul

Fragment Label ID: 

F121

Primer Group: 

b1877

Fragment Producer: 

Licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>70%
Phenotype

Number of Individuals (End): 

21

Phenotype: 

Reduced survival
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Downregulation of gene with unknown function

Q F103

Phenotype CV: 

General

Experiment Batch ID: 

Q

Experiment Contact: 

Start Date: 

10 June, 2014 - 13:35

End Date: 

22 April, 2014 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

40

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

UN22_g1732
Fragment description

Fragment length: 

423bp

Fragment concentration: 

600ng/ul

Fragment Label ID: 

F103

Primer Group: 

b1631

Fragment Producer: 

Licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>70%
Phenotype

Number of Individuals (End): 

18

Phenotype: 

Reduced survival
Upload

Image Quality: 

0
No votes yet

No image no image no image no image no image

Subscribe to RSS - reduced