Submitted by Aina-Cathrine Ø... on 14 June, 2018 - 13:12 GeneralEnd Date: Monday, August 21, 2017 - 10:09Experiment Description: Salmon at 12 degrees were infested in single tanks with 70 knock-down cops/fish. Sampling at 3 and 6 days post infestation. Immun gene response were measured in salmon skin at attachment site. Experiment Batch ID: ExpCStart Date: Tuesday, August 15, 2017 - 10:05Experiment Contact: Aina-Cathrine Øvergård SampleDevelopmental Stage CV: CopepodidCopepodidNumber of Individuals (Start): 420Sex: bothOrganism: Lepeophtheirus salmonis Target descriptionGene or target symbol: AstacinTarget type: mRNAPrimary target ID: EMLSAT00000002095, EMLSAT00000002095-697942 (mRNA) Lepeophtheirus salmonis Fragment descriptionFragment Producer Contact: Aina-Cathrine ØvergårdFragment Label ID: E2095(6965)Fragment concentration: 14.00ng/ulFragment length: 267bpSense sequence: aatgttatgacgactatacaaattgtcccgatttgggccatctttgtggggagaatgatggagttacagaaggctgtaaacttacttgtagattatgttaactcactacggatatatttaactcgttgctattagaatatgtaatttatatgataaatgttcccaaactatatcttaaagcattgttaaaaataagttgtaatatgaatcatacataagtcatttgatgaacttctgaatcttaaggcttaaaataaagaaatttgcFragment Producer: Aina-Cathrine Øvergård ValidationEfficacy of Knock Down: F>94.00% PhenotypePhenotype CV: host related phenotypemodulation of immune responseNumber of Individuals (End): 50 UploadImage Quality: 0 No votes yet påiåp Log in to post comments