EMLSAT00000004874_Var2Frag2

General

End Date: 

Tuesday, July 4, 2017 - 11:47

Experiment Description: 

Fish infested With KD copepodides

Experiment Batch ID: 

Exp2

Start Date: 

Friday, June 9, 2017 - 11:17

Experiment Contact: 

Sample

Developmental Stage CV: 

Nauplius1
Copepodid

Number of Individuals (Start): 

60

Sex: 

both

Organism: 

Target description

Gene or target symbol: 

Heme peroxidase

Target type: 

mRNA

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Antisense sequence: 

Fragment Label ID: 

4874Fragment2

Fragment Batch ID: 

Fragment concentration: 

10.00ng/ul

Fragment length: 

345bp

Sense sequence: 

gcatgaatgagtctggcttaaacttaaaatacccctcgagttatcatgaagaaattaatccaactgtcgcctctgttttcgttgctgctgcatacagatttggccattccatgattcaaaggaatgtgaatcgattggctataaaaaaatatagctatagcagtaattattccttatttaaggacttttttaatacggcaaattacgaggataggaatgggctaggaatagaagaaattttatatgggttgacctatttcccagcacaatctgcagaccgttttgttgtaaaagaagtaactaattatttgttcaataatggaaagccgtatggagcagatcttg

Fragment Mixture Formula: 

Fragment Producer: 

Aina-Cathrine Øvergård
Validation

Efficacy of Knock Down: 

F>61.00%
Phenotype

Phenotype CV: 

Phenotype: 

Upload

Image Quality: 

0
No votes yet

Testing function of vaccine candidate gene from Oslo in cooperation with Elisabeth Gislefoss!