AX F0

General

End Date: 

Thursday, June 13, 2019 - 09:00

Experiment Description: 

Control fragment

Experiment Batch ID: 

AX

Start Date: 

Tuesday, May 7, 2019 - 09:00

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

CPY185

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F0

Fragment concentration: 

600.00ng/ul

Sense sequence: 

TGCTTGAGAGGATGGTCGAATCCGATTGAATGGTGTAAAACTCCAATTTGTAATATAAATGGAAATTCGTGCCTAAATGGGAAGTGTATTTTACCTAATACATGTGCATGCCATGTGGGTTGGGATGGATCCATCTGTGATAAATGTATTCCAAGAGGAGGATGTCAAAACGGAGATTGTGATAATCCCTTTGAATGCAATTGTTCGGAAGGTTGGTCCGGATATAATTGTGATAAAGTAGATTGCCAAAATTGCGTGAATGGAAAATGTACCGAACCGAACCAGTGCATATGTAATCCGGGATGGGTTGGAGATAAATGTGACAAATGCGTCAAAAAACCGGGATGTTTACATGGAAATTGCAACAACAAACCACATGAATGTGAGTGCAGAGAAGGATGGACAGGAGAACTATGCGATATCCCCATTTGCCTTGAAGGATGCCATCCCCAATTTGGAACAT GAGGGCTGGTTCGGATATAATTGTGATAAAGCAAAATGCGACTTTTGCAAGAATGGTAAATGTTTGGAGCCGAACAAGTGCATATGTAATCAAGGATGGGAGGGAGATCAATGCGATCAATGCGTCAAAAAACCAGGATGTCAAAATGGATATTGTCAAAACAAACCACATGAATGCAAGTGTAGAGAAGGATGGAAAGGAGATCTATGCAATATCCCTATTTGCCTAGAAGAATGTGATCCCAAATTTGGATTCTGCGATAAGCCAGGGGAATGCAAATGTATTACTGGGTGGACAGGCCCATTATGTACGATGAAAGAGTGTTCTGTTGTATGTGATTTGGCCAATAGTGAATGTGAAATGGGTATGTGTGTCTGTAAAGAAGGATGGACCGGAGCTAAATGCGATGAATGCATCCCAAAACTAGGCTGTGTTAACGGCGAGTGTAAAGACCA

Fragment Producer: 

licelab

Primer Group: 

likb2502_T7_b2515
Phenotype

Phenotype: 

normal

Number of Individuals (End): 

22
Upload

Image Quality: 

0
No votes yet

Control fragment included in all experiments