CPY185 (negative control), CPY185 (PCR_product) Gadus morhua

Overview
NameCPY185 (negative control)
Unique NameCPY185
TypePCR_product
OrganismGadus morhua (Atlantic cod)
Sequence length849
Associated RNAi Experiments
Table of all RNA interference experiments conducted using this feature, grouped by Phenotype CV: Control
Gallery Image Title Gene or target symbol Sex/Stage Phenotype Datesort descending
K F0 female
  1. PreAdult2
  2. Adult
-Missing-
Control
17.04.2013 - 14:29
13.05.2013 (All day)
Z F0 CPY185 female
  1. PreAdult2
  2. Adult
-Missing-
Control
27.08.2015 - 13:44
02.10.2015 (All day)
AC F0 CPY185 female
  1. Adult
-Missing-
Control
14.12.2015 - 09:08
25.01.2016 - 09:08
AF F0 CPY185 female
  1. PreAdult2
  2. Adult
-Missing-
Control
27.04.2016 - 09:08
08.06.2016 - 09:08
AF F0S CPY short version female
  1. PreAdult2
  2. Adult
no eggstrings
Control
27.04.2016 - 09:53
08.06.2016 - 09:53
AG F0 CPY185 female
  1. PreAdult2
  2. Adult
-Missing-
Control
16.08.2016 - 09:08
22.03.2018 - 09:08
AH F0 CPY185 female
  1. PreAdult2
  2. Adult
-Missing-
Control
08.11.2016 - 09:08
13.12.2016 - 09:08
Table of all RNA interference experiments conducted using this feature, grouped by Phenotype CV: no visible phenotype
Gallery Image Title Gene or target symbol Sex/Stage Phenotype Datesort descending
NAH F0 CPY 185 unknown
  1. Nauplius I
  2. Adult
-Missing-
no visible phenotype
21.11.2014 (All day)
12.01.2015 (All day)
Table of all RNA interference experiments conducted using this feature, grouped by Phenotype CV: female reproduction, no eggstrings
Gallery Image Title Gene or target symbol Sex/Stage Phenotype Datesort descending
AC F0S CPY short version female
  1. Adult
-Missing-
female reproduction, no eggstrings
14.12.2015 - 09:53
25.01.2016 - 09:53
Table of all RNA interference experiments conducted using this feature, grouped by Phenotype CV: -Missing-
Gallery Image Title Gene or target symbol Sex/Stage Phenotype Datesort descending
RNAi_AE F0 both
  1. preadult II male
  2. preadult I and II female
-Missing-
-Missing-
22.02.2016 - 09:50
Properties
Property NameValue
NoteNegative control with (almost) no blast hits to the louse genome
Sequences
The following sequences are available for this feature:

PCR_product sequence

>CPY185 ID=CPY185|Name=CPY185 (negative control)|organism=Gadus morhua|type=PCR_product|length=849bp
ggcaaccatgaagtctcttatcttcgttctgctcctcggagctgtcttcg
ctgaggaggacaagatcgtcggagggtatgagtgtacgaggcactcccag
gcccaccaggtgtctctgaactctggataccacttctgtggaggctccct
ggtcagcaaggactgggtggtgtctgctgctcactgctacaagtcccgta
ttgaggtgcgtctgggcgagcaccacatcagggtcaacgagggaaccgag
cagttcatctcctcctccagcgtcatccgtcaccccaactacagctccta
caacatcgacaacgacatcatgctgatcaagctgagcaagcccgccaccc
tgaaccagtatgtgcagactgtggcccttcccaccgaatgtgctgctgat
ggcaccatgtgcaccgtgtctggctggggaaacaccatgagctccgttga
tgacggggacaagcttcagtgcctgaacctgcccatcctctcccacgccg
actgttccaactcctaccctggcatgatcacccagtccatgttctgcgct
ggctacctggagggaggcaaggactcctgccagggagactccggtggccc
cgtggtgtgcaacggtgtgctgcagggtgttgtgtcctggggatacggat
gtgctgagagggacaacccccggcgtctacgccaaggtctgcgttctctc
gggctgggttcgcgataccatggcaagttattaaatgatcctcttcagat
tcctgtagcagcttcacatcagnctgttaatggagaaaatgatatgatca
taagtttaaanagaaatcntaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
back to top
Add to Basket