|
Associated RNAi Experiments
Table of all RNA interference experiments conducted using this feature, grouped by Phenotype CV: no visible phenotype
Gallery Image |
Title |
Gene or target symbol |
Sex/Stage |
Phenotype |
Date |
|
Z F219 |
CMi2471 |
female |
-Missing- no visible phenotype |
27.08.2015 - 13:44 01.10.2015 - 00:00 |
Properties
Property Name | Value |
Note | Negative control fragment, Gadus morhua clone V107 immunoglobulin M heavy chain constant region variant B mRNA, partial cds |
Sequences
The following sequences are available for this feature:
PCR_product sequence >CMi2471 ID=CMi2471|Name=CMi2471 (negative control)|organism=Gadus morhua|type=PCR_product|length=427bp gcggccgctctagaactagtggatcccccgggctgcaggaattcggcacg agggtttttttttattattttgattttgaatcagcattttaaaaagacaa acatgcagcattacatcacacacagaaaaacaacatctactggggcaagc acgtagaaggacccaggttcatgttgataatgttaacattgcctgatgac ttttcagtaattaacttgacaatgggttggtttttggaatccatagacat gtggtagacttcgcatctaaacactctgccgtctttccaaccatcagagc tgaaggtaagttggccataagtggaaaacaagtcgccgttttcaattacg tttgttgttttgtgtgaataaagagcatttccatctattgtcaaattatc aaccagccaatgcaccaaaatgtccgc back to top
|