EMLSAG00000000014, EMLSAG00000000014-682780 (gene) Lepeophtheirus salmonis

Overview
NameEMLSAG00000000014
Unique NameEMLSAG00000000014-682780
Typegene
OrganismLepeophtheirus salmonis (salmon louse)
Associated RNAi Experiments

Nothing found

Homology
BLAST of EMLSAG00000000014 vs. L. salmonis peptides
Match: EMLSAP00000000014 (pep:novel supercontig:LSalAtl2s:LSalAtl2s1004:40970:48940:1 gene:EMLSAG00000000014 transcript:EMLSAT00000000014 description:"snap_masked-LSalAtl2s1004-processed-gene-0.11")

HSP 1 Score: 328.176 bits (840), Expect = 8.235e-116
Identity = 164/164 (100.00%), Postives = 164/164 (100.00%), Query Frame = 0
Query:    1 MDELESTNSGETNNGEEEEEEGEGEEEEDTGLTFSRELGDGESTSPNNTIQELPAAIQKKASKSTRNFSDRARRSRSEVRRQQQKTEPLDNRAWSKSPVKCRYRRPKNFLQTKPIPDLSERLSNSSSTSSFTQSLGELIPYIEGLLNRKLSGPNLCIKFNNQNN 164
            MDELESTNSGETNNGEEEEEEGEGEEEEDTGLTFSRELGDGESTSPNNTIQELPAAIQKKASKSTRNFSDRARRSRSEVRRQQQKTEPLDNRAWSKSPVKCRYRRPKNFLQTKPIPDLSERLSNSSSTSSFTQSLGELIPYIEGLLNRKLSGPNLCIKFNNQNN
Sbjct:    1 MDELESTNSGETNNGEEEEEEGEGEEEEDTGLTFSRELGDGESTSPNNTIQELPAAIQKKASKSTRNFSDRARRSRSEVRRQQQKTEPLDNRAWSKSPVKCRYRRPKNFLQTKPIPDLSERLSNSSSTSSFTQSLGELIPYIEGLLNRKLSGPNLCIKFNNQNN 164          
The following BLAST results are available for this feature:
BLAST of EMLSAG00000000014 vs. GO
Analysis Date: 2014-04-02 (Blast vs. GO)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of EMLSAG00000000014 vs. C. finmarchicus
Analysis Date: 2014-05-09 (TblastN vs C. finmarchicus TSA)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of EMLSAG00000000014 vs. L. salmonis peptides
Analysis Date: 2014-05-10 (Blastp vs. self)
Total hits: 1
Match NameE-valueIdentityDescription
EMLSAP000000000148.235e-116100.00pep:novel supercontig:LSalAtl2s:LSalAtl2s1004:4097... [more]
back to top
BLAST of EMLSAG00000000014 vs. SwissProt
Analysis Date: 2017-02-10 (Blastp vs. SwissProt)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of EMLSAG00000000014 vs. Select Arthropod Genomes
Analysis Date: 2017-02-20 (Blastp vs. Selected Arthropods)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of EMLSAG00000000014 vs. nr
Analysis Date: 2017-02-20 (Blastp vs. NR (2/2017))
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of EMLSAG00000000014 vs. Tigriopus kingsejongenis genes
Analysis Date: 2018-04-18 (Blastp vs. Tigriopus kingsejongensis proteins)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
LSalAtl2s1004supercontigLSalAtl2s1004:40970..48940 +
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
ensembl2013-09-26 .965016
Blast vs. GO2014-04-02
TblastN vs C. finmarchicus TSA2014-05-09
Blastp vs. self2014-05-10
Blastp vs. SwissProt2017-02-10
Blastp vs. Selected Arthropods2017-02-20
Blastp vs. NR (2/2017)2017-02-20
Blastp vs. Tigriopus kingsejongensis proteins2018-04-18
Properties
Property NameValue
NoteHypothetical protein
Logic nameensemblgenomes
Descriptionsnap_masked-LSalAtl2s1004-processed-gene-0.11
Biotypeprotein_coding
EvidenceIEA
Cross References
External references for this gene
DatabaseAccession
Ensembl Metazoa (gene)EMLSAG00000000014 (primary cross-reference)
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
EMLSAT00000000014EMLSAT00000000014-695861Lepeophtheirus salmonismRNA


Sequences
The following sequences are available for this feature:

gene from alignment at LSalAtl2s1004:40970..48940+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EMLSAG00000000014-682780 ID=EMLSAG00000000014-682780|Name=EMLSAG00000000014|organism=Lepeophtheirus salmonis|type=gene|length=7971bp|location=Sequence derived from alignment at LSalAtl2s1004:40970..48940+ (Lepeophtheirus salmonis)
GGTTCTTATATCCACTGACTTGTTAAGAATAATTAATACTTCATATTCAT TACTGTGTTACTACCATTGCATTCTTCTTTTAGATTCGACAGCGTACTTT TTGGAAGAAAAAACAAAACAAAAAACAACATATAGGTAAGATGATCAATA ACTCCTTTACCAAATCAGCAAACATTTCCTAATATGACGTACCCAGCAAA AAAAATAACCTTTTTCAGAAAATAATTTTTATTTCTACTGTTGAGTAACC TTATTAAAAAATGTTTAATTAGTTTATTTAAATTTCTACAAAATTGCATA CAATTTGGGGCCTGGAGCAAGTGTACCTCCTTAACAACAGCCCTAGTTAG GACCAATTGTTAGTGGTATGAAAATTATGGAAATACACACGATGATAAAT CAAAAAGAAAAGAATATGTTAGAAACTTTGATAGACAACAGTATGCTGAC AGAGATCACTATCAATACTATAATATTTAGTAATGTAGATTGTGTGTATT TTTTAGCTGGCCCGTTTTTTTGGAATTTGTATTCTGAAGAATTTTCTCTT CATTCGCTGTTGTCAATATTATTTACCTCAAGAGTATTGAACTTCCTTTT CTACGACATTCAGTTATATTCCAAATCTGATTAAACATTTGTGTGTGCAT ATAAAAGGCAGATAGTAATCTTGAGTATTTGTTGTGGAGTTATAATTGTA AGTCCCTGTTGGACTCTGATAGAATTGAGGATCGTCATCNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNTTGTGGAGTTATAATTGTAAGTCCCTGT TGGACTCTGATAGAATTGAGGATCGTCATCGAAGTAATCATTGTTCCTTC TTCAAGTTAATATAGTTACAATTTTTTTTTTAAATTTTTTTTTGAACATG CCCAAAATTCACAAAATTTTCATCAGTAATTATATTTTTCCTTGCTCGCT AGTATATATGTTCACAGTTTGGGAAAAATAATTATGAATATTAATACCTT GCAGGTTACCAATACATACTTTTTTATACAAGGGTTTTATACGGGCGGTA CATTGAAATCTGAGCACTGACTAATTCAAAAATGAATGAAGGTTGAGTTA TTNATTAAAATTAATTCATATTTGATATATGTAACCATAAATAAGTAATT ACAAAACAGAACAATCGTAAGCTGCTTAGTTTGCGTACAAGTTGAGATAA TGTTACTTGAAAGTGATCGACGAATTTCCATTCGCACACTCCAAGAAGTT AGGGGTCTCCAGTACCACCGTCTAAGCCACCAGGAAGTCCGAAACATTGG AAAGGAAAATAGGTTCAATCAAAAAGGTAAAAATGGATCAGGAGAAGTAA AAGAAAACAGCCCAGGCCAACTCCTCAAGTTCATGCCCATACGAGAGATC TCGGGGTTTCACTGTTCAGAGAGCTATAAAAAAAGTGAGTAGAAAGAGCT CTGTGAGAGTGAAGAGTCCACTTTGGACATCATCAATTAAAGAACCCCAT CTCTTCTACTGCAAGACTCTTTTGAATAAGTCTTTTGAGTTCTATTGATG ATATTTTATGACATTTTTGACCTCCCTACAGTCATTATGCCAACCACTTC GACTACACCTTTTGGTTGCATGGTAATTTGCATGTTTAAATAAAAATTAA TTAGAATATAATTTCATCCGGGGCCCTTACAGGTAGGATCCCCTAGTCTT AAACCTAGGTTCGTGTATACTATGATCCTCACTTCTTTTAATTGGTTGAC CAATTAAGATAATAAAATTAGAAATTTGTTTTTGCTTAATCATGTATGTA AGGACTGGTATCGGTGGAATGGGAATTATTGAGCCGATTGCGCTACTTCA AAAATGGTCAATTCTTGTCGTTTCCGATGCATCAGTACACCCCTAATATA ATCATGAACCCAACTCCGTGTATAGCAAGAACATATAGGCTGGAATTACT CCGATTTCGATACTCAACTATACTATGAGTCCAACAAGGATAAGCCTGGT TGTTACTCACCGTCTTTTTTGACAACACGTACAAGTTATTACTTTATACT TAAATGTTTCCTTCCAAGAGTTAAATAATAATGATAAAAGCTATCGAAAA AAATAAATCCTGTTCACGCTGCAAATACAAACTGTATCTCCCACTTTCTA AAATATATTTTAAAAAACTATTATGATTCTATATTCCTTAAATCCTATTC ATTCTCCTTTTTTTAAACATACAAAAAATGTTAATGAAAGACGCTCTCAT TGCGTATATATACATAGAGGAGTATGTGTTGTACTCATAAATAAGTGATA ATGTTTTGTCTGTAGTAGTACTAGAGTTGTATAAAATATGTACTAGATAG GGGGAGGGACTTTTTTGCAAGGCAATTTKAAANTGGGTTTTTAGATACAG ATTATTGAAATGTGTTTCCTAAAAATTTAATATTTGAAATTTCATTATTA AAATTTTTTTTTAAAGAATTTAATTGTCTGGGAATAGCTATGAATTTTTA AAATGATTTTCTAAAGAATTTAATTTTCTGTGTAGAACTATGAATTTTTT AAAATTTTTTTTGCAAAAAAATTAATTTTCTGTTAATACATATGAATTTT TCGAAAATTAAAAAAAAAAAAAATCAAATGTTCTTCTAAGAAATTTAAWW TTTTTTTTTCTTTTTTTGGATTTTGGATTTTTTTTTTTTCAAAAAAATTC CAACAGCTAAGCCTCCAAATATAATCCTATGGACACCCCTCTATACAACA TTCATAATCATTCCCATCACAGATAGAGTTCCGTGAGTAAAACAGGAGGC AAAGACAAAATATTTTGATTTTTCTTTGTGTGGTTTCAATAATCTATACA ATCATAAAAAAATACTTTAAATATTTAATATTTTTTTCTTCAAGCCCTAA TTCATAAATAAAAATAAAAAGTTAAACATTAAAAGGAGTAAATCATTTTT ATATTTGTTTATGTAATTCCTCTTAACATAATAGTAGGTTGGGGAAAAAG TAATTTCGTATTTAAAATAAATTTATCTTGTTCATTATTGGTCACATTGG ATCATACGATATAGCTTTGTGAAGGTTTGACTATATAGTACAAACACATC TTGTACATTATTGTACTTGGACGGTTCAATCGAGAATTATCTTGCGTCGA GTCTGGAGGTCTAAAATGAAGAAATTTGCCATATTTTACATTTCATTTAC CAGAAAGGGAAACACGCCTTCCAAAGCGACCAAGAAAATTTGCAATATAT ACGGGACCGATACTCTTTCGGTTAGTGAGTGGTTCGAGTGATTTTTTTCC ACTCAATTTTGCCATCTACTGTGAACAACTTGMCCGTTTCAAGTTGGCAA TCGAACAGMCSCAGCCACAATTGGCAAATAGGAGACAACAAGACATCATC ATGACACACCCTGGCCGTAAACATCTTTGATGATCTAAGGAAATGTCATG GCAGSTAAGCTGATCGCCTCCCAAAATATTCTGCCAATTGTTAGGATTAA AACGTTCATTTTCGATATCTTTTATTTTTACATACCGTTAGGACATATTT TATACATAATTAGGTAGTGCCATTATATTAATGTGTTAATTTGTAAAACT TTGTTTAAAAATAGTAGATCCCACATAAAACTGGGGTCATGCAAGAAATG TCAAAGGCTTTTCAAGGTTTGTCCATATTGCGAGTACTCAGAGGGGCGGC CAAACTTTTTGTTCAATTAAGTATTAGTTATTTTTTCAAATTTTCAGAAG GTCAATTTTATATTATATATAAGGCAGTAAAACACCAACAGGTAGATACT GTTTAAGTTGGTTCCCTCTTTTTTGATGGAAAGTAAGTTATGTTGATGCT TCATTCTTTTCGGTTCCTCAGTCAAAATTCACAGTTCAGGGTCCGGTTAA TTTTGTAAGAACTGGTTTTTTTAAAAGTATTTATTATATGTAATATAATA TACAGTAGTTTATTTAATAGCTTCATATTATCAGTTCTATTTTGTCGTAT TTATTTTAATTGTCAGCGAAGAGTAGTTAAATCTATTAGGGATTTATGAT CTGATACTGTTGTCATTGAATAAATTAATTTCTTTATAAATATCTAAATA CTATTCATTGCATGGGATTTTTTGATACAAGGTATTGTATAAAACATATC TTGCACGTATTCAATAATAAAAGATGCCGGGGAAAAACTTGGTAATCCAG ACAACTTAAAGCACGTTTGGGAAGAGAGTAGCTTAGCTCTCATGACGTTT TATTAGATCAGCTGTCTGCAACCCTAAGAGAAATGAAATACACACTAATC CAACTGTTTATTTAGCAAGGACATATAGGAAATAATTAAGGGATGCCGAT CCAAAATTCTACTCCGAGCCCAAATTACACTTACACTTATAACTCCAGAG AAAATCCTCGTTGTAAGTCTTTGTCTTTTATGATCAGAAACACTAGTTAA TACTTTATCCTTATATGTTCTGTCTTAAAGAATTAAATGACAAATATAAA ACTCAGTTCAGATTCCCAACTACAAGAGGTTTCTCCTTCTTTCTGAGACA TATTTTGTACACATCCTGATTTGTAAGTTGGGATATACTAGTTTTGCATT TCAGTCTAGAACCCCTTCACTGATTCGAGACATTTATGGTTTTTAGATGA TCATAACAATTCTTTCCTTGAAATAAATTCGGTTTGATCCGGTCTCGAAG AAAAATTCGATTCCAATCGGTTTTACACAAAATCGGATTGATTCAATCTC GTTTAGAATTCGGTCTAGACTGATGCTATATATGAATTGTCGATGAAGTC AGTTGTGTATCATCGACCTTCAATGTCGTCATATGAAGTTAAATAATTCA TATTTATAGAACTCATTCATCAGGAATGAGCAAAAAATCCTTCTAGGGTT GGAGAACGATTAAATGTTGATCTAAGGTCTGAGATTGCAGTTTGTATCAA AATATCAGTTCAGATGGGTATAAAAATATTTTAAGATTGAACCGGAAAAA AGTTTGGTTTTGGACCAAGTCTCAACACTAGTTTTTTCTTAGAATAGTTA GGTATGTACTTTGCATGATCCAAATTTATTGTTGGCGTGCTTCAAATAAA AAGCAAAAAATTATTAATAACCAATTTGGAAGTCAATATCATATCATAAA CGGATTTATTAATATTTGAAGTTTTTTAAAATCATTAATTGAAAAAAGAA AGAGGAGGAATGGAAACAATAAGAAAAGTTTAAATGTTTTTTGTTGTTCT TGATAAAATATATATGTATTAGTTATTACTCAACAAACAATTTAGAAAGC ACTACACATTAAGGAAAATTTCTTAATGCAAAAAAAAAAAAGTAATAAAA TATATAATTTAATCCTTAGATAATTATTATTGGGGCCATGAAAGTAAGGG CCTGTACCACTTTAAACTACTTACGGGAAAATAAGCTATAATTAAGGTAG GGAATTTTGTTCAGAAAAAGTTGAATTACAGGAAATAAAAAATGTTAATA TCTCTTATGAATAAAAATTGTAGTATATTGTTCTTGCATTAGGTTTGGAT CACAGTACCCTAATTGTAAAGGGGATTATTCTCAGTGATGCATACAAGGT ATGTAAAAATAAAAGAAACCAAAAATGAAATCAGCTTAGATTTTATGACG TTATAGTAGATCAATGGTTGTATTGTCTAAAACAAAAAGCTCAAGGAATG AAATAGAGGAACAATAATTGTTGTTAAAAATGACTATGAAAATAGTAGCC ATCAAGGCAGTTAGTTAGGCAACTTCGAGCCCACTAAATGAAATAAAATA GTATGAAATAAGCGCTATTTGAAATAATGCACAAAAAAATTGTGTAATTT TCAAACACATAAAATATTTCACAATTTTTTTAAAATATAAAAACTTTTAA AGGTCTTTAATACAATTAAATGTACAATAAGTTAGTTTGAAAATCAATTC ATTATTATTATTGTCAAAAAATGGTGATTCTTCCTAATTTGTACTCAATT TATGCATTAAATTGAGATATAAGGCGTCGACTAACAGACTAACTTTGTTT TATTACTATAGAAGATTTTTTTCACTTGATGTGAAGAGCCAATAAATATT TTAGTCTTTAGAGAACTCACTGGTTGTGCTTTACTTAGGCCCATACGTTG CTAAACCTAATCTAAAGTCATATTTATTATTTTTTAATGATGTACTTCCT TTTTTTTTGAAATACGAACTCATTGTTGAAAATGAGTCTTCATCTGACAC AAACAATCAAATGCTAGAATATAACTATAATACAATTGTACTTCAAATAT AATTCATCAAATCATCAGTATAGATGACAGATGGTAAGATTGGGTATTTT TTAGAGGTCAAGGAGCAAGTGAGAGCGAGACTGGACATATTACTTTTGAA TTAATCAATTATAATTAATGCCCTTATTAAAAGTAACTACATTTTTGTAT AATTATGGGGAAGAATGATAAGCCTTACTATATGCGTCTGTAAAGTACCA GAGCGCTTATAAATTAGGTGCCTTTATCCGAAGATGGCAACTGGGGCCTT TTAGCACTAGAAGGCGTTTTCACTAACTTCAACAAAATTTGCAATTCTAT CCCTCATAAAGTTAGAAAACCATTAGTGCTTCTCAGGAAAACACTAGCAG AGTCCGGATCACTTCACCATGTCGTGAGCGCTCTCTTTCCCATTTTTAGA AACAATAAGTTTGCTTCCACTTATCCTTAAATTGAGCACAAATTATTAGT GTTGCTGATTGGGAGCATTTTGGGCATCTGAATAATAAAGAAACCCAAAA KCAATATGATAACCCGCACAAAATAAAGAATGTTTTGGAGGAGAACAGCT TAGCTGTCATGACGCTTCATTACATCAGCTACATTCAGCTGAGAAGAGGG AAGGGGAAGAAGGCAATCAACAAGGACATTGGTAAGAATTACTCCAATTT CAATCCTCAATTCTACTCTGAGTCTAACAAAGACTTAAGATTGTAACTCT ACTCAAATACTCAAGGCTACTCCCCACCTTTTATGAGCTGACATGCATGT TCAATACGCTGTTGAATATAATTTAATGGAGCAGAAAATAGTTACATAAT AATGACAACAGGTCATGAAAAGAAAATTGACTCTTAAGTTTGGAAACTCA AAAACAAAACAAAAACGGGCGAGCTAAGAAATACACCCGATTTTTATCAT GACTAAGTATGTTTTTCAATATTTGTTTAGAAAATACATTTTATATGTAA GAAGCAATGTTTTTTCTCTCATCTTTAATAGTAAGCGCGCTCGCTCTTTT GCACATGAATCTTAAGTACTGCTCACTAATGCTTCGAGAGTTAATAAAAC TCTTCATAAAATAATAATAATTTAGATATAGTTTTAAACCTTTTAGTGAG TTCTTCCAAAATGGACGAACTTGAGAGCACGAATAGTGGTGAAACTAACA ATGGAGAGGAAGAGGAAGAAGAAGGAGAGGGAGAGGAAGAAGAAGACACT GGACTTACATTCTCAAGGGAATTAGGAGATGGAGAATCAACTTCTCCAAA TAATACGATTCAAGGTACTTTTTTTTACATCTTTTATCGTCCCACTAAAC CATTATCAAATTCATCATTTCAATCCTCAGAGTTACCCGCTGCAATCCAA AAAAAGGCATCCAAATCCACTAGAAATTTTTCAGATCGAGCTCGCCGAAG CCGGAGTGAAGTTCGTAGACAACAGCAGAAAACAGAGCCATTAGACAATA GGGCATGGTCAAAGTCTCCAGTTAAGTGTCGCTACAGAAGACCCAAGAAC TTTTTGCAGACAAAGCCAATTCCAGATTTGAGTGAGAGATTATCCAATTC TTCAAGTACGAGTTCCTTCACTCAAAGCTTAGGTGAGTTAATACCATATA TAGAAGGGTTATTGAATCGCAAATTGAGTGGGCCTAATTTATGTATCAAG TTTAATAATCAGAACAACTAG
back to top
Add to Basket