D F29

General

End Date: 

Wednesday, October 3, 2012 (All day)

Experiment Batch ID: 

D

Start Date: 

Friday, August 24, 2012 (All day)

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

36

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

g2282_trehalose

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F29

Fragment concentration: 

600.00ng/ul

Fragment length: 

501bp

Sense sequence: 

cttcaattgcatcacaagctgcgcttctcatgggctgtagtttgggttggtcaagccccgtaatcgtattattaagtaaatcaaaggatggatttgttctcagcaagtcagaagagggatggttggcctccatattattctttggtgccatagcaggaggtccttgcgctggatacctgattgacaaatctggtcgaaaattggcgttaggagtcaatgctgtattgtatgcattgtctcttggagttattgtatctgcgcaatataagtggatgctatttgcaggacgttttttaaatggtgtgtcatgtgggtttacttctattagtgccccaacttatatctcagaaatttcttcagcgagattgattgaaagttggcgttggattactgtttctattattataatggattccatatggttattttttctctattttattccggaatccccagtttatcatctgataaataacaacgaacctttagcaaggagcgttc

Fragment Producer: 

licelab

Primer Group: 

g2282_trehaloseF_b836
Validation

Efficacy of Knock Down: 

F>59.00%
Phenotype

Phenotype CV: 

Phenotype: 

a bit short eggstrings (?), other wise normal. One very strange looking animal

Number of Individuals (End): 

12

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Knockdown of 6214