female reproduction

AV F404

Phenotype CV: 

General

Experiment Batch ID: 

AV

Experiment Contact: 

Start Date: 

14 March, 2019 - 08:35

End Date: 

24 April, 2019 - 08:23

Experiment Description: 

injection into pradult females
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult1
Adult
Target description
Fragment description

Fragment length: 

400bp

Fragment concentration: 

600ng/ul

Sense sequence: 

TGTTGGCCCTATGAGTCCATCT TTTTTGTGACTTTGATGCCTTGA

Antisense sequence: 

TGATCCTTGGAAGAAAAGAGGATG TTCATCATTTCCAGCATTGAGTTT

Fragment Label ID: 

F404

Fragment Mixture Formula: 

50% of both, in total 600 ng/ul

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>50%
Phenotype

Number of Individuals (End): 

15
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of FCGPO1 & FCGPO2 leads to missing/abnormal egg strings.

 

AS F384

Phenotype CV: 

General

Experiment Batch ID: 

AS

Experiment Contact: 

Start Date: 

21 August, 2018 - 09:08

End Date: 

24 September, 2018 - 09:08

Experiment Description: 

Knockdown of one cement-gland gene.
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description
Fragment description

Fragment concentration: 

600ng/ul

Fragment Batch ID: 

F384

Fragment Label ID: 

F384

Fragment Mixture Formula: 

F381+F382+F383 in same ratio
Validation

Efficacy of Knock Down: 

F>99%
Phenotype

Number of Individuals (End): 

21
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of EMLSAT00000002328, EMLSAT00000011195, EMLSAT00000010070 leads to missing egg strings.

 

RNAi_AS 11369+12062

Phenotype CV: 

General

Experiment Batch ID: 

RNAi_AS

Experiment Contact: 

Start Date: 

21 August, 2017 - 13:24

End Date: 

24 September, 2018 (All day)
Sample

Organism: 

Sex: 

female

Developmental Stage CV: 

preadult II femal
Target description
Fragment description

Fragment Label ID: 

F389
Validation

Efficacy of Knock Down: 

F>90%
Upload

Image Quality: 

0
No votes yet

developmenta details, no egg-strings, no gut contant. All genes downregulated by around 90%

RNAi_AS 11366+11369+10832

Phenotype CV: 

General

Experiment Batch ID: 

RNAi_AS

Experiment Contact: 

Start Date: 

21 August, 2017 - 13:24

End Date: 

24 September, 2018 (All day)

Experiment Description: 

Sample

Organism: 

Sex: 

female

Developmental Stage CV: 

preadult II femal
Target description
Fragment description

Sense sequence: 

Antisense sequence: 

Fragment Batch ID: 

Fragment Label ID: 

F388

Fragment Mixture Formula: 

Fragment Producer: 

Validation

Efficacy of Knock Down: 

F>90%
Phenotype

Phenotype: 

Upload

Image Quality: 

0
No votes yet

developmenta details, no egg-strings, no gut contant. All genes downregulated by around 90%

RNAi_AS 11366+12062

Phenotype CV: 

General

Experiment Batch ID: 

RNAi_AS

Experiment Contact: 

Start Date: 

21 August, 2017 - 13:24

End Date: 

24 September, 2018 (All day)
Sample

Organism: 

Sex: 

female

Developmental Stage CV: 

preadult II femal
Target description
Fragment description

Fragment Label ID: 

F386
Validation

Efficacy of Knock Down: 

F>90%
Upload

Image Quality: 

0
No votes yet

delevlopmental defects, empty intestine, no egg strings. Both genes are down-regulated by around 90%

AS F379

Phenotype CV: 

General

Experiment Batch ID: 

AS

Experiment Contact: 

Start Date: 

21 August, 2018 - 09:08

End Date: 

24 September, 2018 - 09:08

Experiment Description: 

Knockdown of one cement-gland gene.
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

EMLSAT00000008518
Fragment description

Fragment length: 

483bp

Fragment concentration: 

600ng/ul

Sense sequence: 

GGACGGTGTGTGACTCCAAACACCTGCAAGTGTGATTCTGGGTGGAGGGGTGATACCTGCAATGAGTGTATTCCCTCATCTCAGTGTCAAAATGGATTTTGCGTTCATTCTCCGAAGGAATGTATCTGCAGTTTGGGCTGGGCTGGAGTAAACTGTGATCTACAGGATCATGGATGTGTCCATGGAACCTTTTCATCAAAACATCACTGCACATGCGATCCGGGATGGTTAGGAAGAAATTGCAGTTCTTGTATACCGCACCCAAGTTGTGTTTGGGGATCATGTAAATCCACTCCGGGCGAATGTTTTTGTGATCCAGGATGGGATGGAAGGAATTGTGACATCCCCATTTGCGAGAAAGGGTGTCATCCAGATCACGGATTTTGTTTTAAGCCATCTCAATGTATATGTCGCTCTGGTTGGCATGGAAAACGTTGTGATCTTTGCACTCCAATGCCTGGATGCACACGAGGATGCCATAAA

Fragment Batch ID: 

F379

Fragment Label ID: 

F379
Validation

Efficacy of Knock Down: 

F>90%
Phenotype

Number of Individuals (End): 

15
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of one of the hemicentin-like genes leads to abnormal egg strings.

RNAi_AN 10832+11366+11369+12062

Phenotype CV: 

General

Experiment Batch ID: 

RNAi_AN

Experiment Contact: 

Start Date: 

1 November, 2017 - 13:24

End Date: 

3 January, 2018 (All day)
Sample

Organism: 

Sex: 

both

Developmental Stage CV: 

preadult I male
preadult I female
Target description
Fragment description

Fragment Label ID: 

F345
Validation

Efficacy of Knock Down: 

F>90%
Upload

Image Quality: 

0
No votes yet

delevlopmental defects, empty intestine, no egg strings

AL F339

Phenotype CV: 

General

Experiment Batch ID: 

RNA_AL

Experiment Contact: 

Start Date: 

28 August, 2017 - 10:00

End Date: 

6 October, 2017 (All day)

Experiment Description: 

Knockdown of the nuclear receptor FTZF1
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Adult
Target description
Fragment description

Fragment length: 

499bp

Sense sequence: 

gtgatagggcacggaaactgcaagtcttgcgt Caaagacaagtgatacacggtggagtttccatgggcccaagtagcatgaataatacgaca Accacaacgagtagtagtgcatcctacggcggcggtgcctccggtggaatgaactccacg Agtagccctccatccatgaacaataataataataacaattccccctcaatctacggctca Cccatcactcatattaaacaagagatacaaataccacaagtcacatctatgacgtcttca Ccagatacttcaccctctcccgttcatttacccggaatgatttctaatcctggaggcaat Ccaatgggtggagatactccgggctccaatcccatcattgcccaacagactgatcctgcc Ggaggtattcaatggcagatcaatgctgctggaaagcatcaggatatccaaagtaatcaa Ggaactgggaaaatgccagccatcattcgagaattccttgcctccct

Fragment ID: 

Fragment Batch ID: 

F339

Fragment Label ID: 

F339

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>45%
Phenotype

Number of Individuals (End): 

7

Phenotype: 

No eggstrings
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of FTZF1 targetting both isoforms, alpha and beta. Only alpha is downregulated, few survivors. Sectioning reveals disorganization of eggs in genital segment, resulting in no eggstrings, same as probe F338 (other entry).

AL F338

Phenotype CV: 

General

Experiment Batch ID: 

RNA_AL

Experiment Contact: 

Start Date: 

28 August, 2017 - 10:00

End Date: 

6 October, 2017 - 10:00

Experiment Description: 

Knockdown of the nuclear receptor Fushi tarazu factor 1 (FTZF1)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Adult
Target description
Fragment description

Fragment length: 

467bp

Sense sequence: 

cgccttcatcatcgacaacaacatccatactaacctcatctacaaataaaaaacctcgttccctcaaaatcgtcgaatgtctcgactct tcctcgacgacacacaccacagcctctccatcgtcgccatcaacctcttcatggaatctc Attcttccttcgcatccttccgtagaatcaccttcatcgtcttcgagtccttctcatcaa Ggagggggagataaagagatatcctctgtggttatagcagcctctacgaccacgacagca Actaaaagatcatttagtcaacatatcatggaagaagaggaagaggacgaagacgaagaa Gaggctggaggacacttatcttggaaccctgatgaagagcaggatcaatcagctgaggag Gatgcaggactaccaacagcatccagtaacaacaactccgctggatccacatccggagacttcggtcctggagttgtg

Fragment ID: 

Fragment Batch ID: 

F338

Fragment Label ID: 

F338

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>45%
Phenotype

Number of Individuals (End): 

12

Phenotype: 

No eggstrings
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of the nuclear FTZ-F1 in pre-adult 2. Knockdown resulted in strange genital segments. Sectioning revealed disorganization of eggs in genital segment.

AL Hormone receptor 3 (HR3)

Phenotype CV: 

General

Experiment Batch ID: 

RNA_AL

Experiment Contact: 

Start Date: 

28 August, 2017 - 10:00

End Date: 

6 October, 2017 - 10:00

Experiment Description: 

Knockdown of the ortholog of the nuclear receptor HR3. Injection of pre-adult 2 females
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

EMLSAG00000000733

Target type: 

mRNA
Fragment description

Fragment length: 

441bp

Sense sequence: 

gccta Gcaccattcgagcaagaaatctcattgcaaaacaaacaaacaaaaaggattcatagaata Aatagaaaaaggaccctacaaggcaaaaaaaacagcaactattttttacaaattgtttcg Tactcgtcgatgcaaaatcagaaatattatacgaatttgtcctcaatggattggatatca Ggctatcgtcttccatccaattcggatttaaagtgtgatgatgatcaccatggcggcggg Gcaggagtacagcatgcatctgttgtcggcggaccaacaggcggagcactaggatctggc Tcttccggtcccctcacaaacaacaccaattccaactcttcctcaccctccatgctaggc Atgtgggcagcagctgtggccaatacacctcttaaagtggaaacagctgatcatcatgga Aatggatctctggtgg

Fragment Batch ID: 

F341

Fragment Label ID: 

F341

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>90%
Phenotype

Number of Individuals (End): 

17

Phenotype: 

No eggstrings. Disorganization of eggs in genital segment
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of HR3 in pre-adult 2 females. Resulted in no eggstring production. Sections reveals disorganized eggs in genital segment. Ovaries look normal.

Pages

Subscribe to RSS - female reproduction