female reproduction

Mucin-like spermatophore wall protein 2 (AJ F270)

Phenotype CV: 

General

Experiment Batch ID: 

AJ

Experiment Contact: 

Start Date: 

21 March, 2017 - 09:08

End Date: 

25 April, 2017 - 09:08

Experiment Description: 

injection into young adut males, checking reproduction & spermatophore attachment of females
Sample

Organism: 

Sex: 

male

Number of Individuals (Start): 

30

Developmental Stage CV: 

Adult
Target description

Primary target ID: 

Gene or target symbol: 

MLSWP2
Fragment description

Fragment length: 

497bp

Fragment concentration: 

600ng/ul

Sense sequence: 

CCAGGCTTTTCACACGCTTT

Antisense sequence: 

GCTCTTGGCCGAGCATAAAA

Fragment Batch ID: 

F270

Fragment Label ID: 

F270
Validation

Efficacy of Knock Down: 

F>80%
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

male specific gene; checking spermatophore attachment to female

Mucin-like spermatophore wall protein 1 (AJ F269)

Phenotype CV: 

General

Experiment Batch ID: 

AJ

Experiment Contact: 

Start Date: 

21 March, 2017 - 09:08

End Date: 

25 April, 2017 - 09:08

Experiment Description: 

injection into young adult males, checking reproduction & spermatophore attachment of females
Sample

Organism: 

Sex: 

male

Number of Individuals (Start): 

30

Developmental Stage CV: 

Adult
Target description

Primary target ID: 

Gene or target symbol: 

MLSWP1
Fragment description

Fragment length: 

527bp

Fragment concentration: 

600ng/ul

Sense sequence: 

TTACGTTGGCAATCGTCGTC

Antisense sequence: 

GAAATCAAGTGCGGCTCCA

Fragment Batch ID: 

F269

Fragment Label ID: 

F269
Validation

Efficacy of Knock Down: 

F>95%
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

male specific gene; checking for spermatophore attachment to the female

LsRXR

Phenotype CV: 

General

Experiment Batch ID: 

LsRXR

Experiment Contact: 

Start Date: 

13 March, 2015 - 11:54

End Date: 

7 April, 2015 - 10:02
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

50

Developmental Stage CV: 

Adult
Copepodid
Target description

Primary target ID: 

Gene or target symbol: 

LsRXR

Target type: 

protein_coding_primary_transcript
Fragment description

Fragment length: 

301bp

Fragment Label ID: 

RNAiFr1

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>60%
Phenotype

Number of Individuals (End): 

38
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

Background

C F4 (CopB2)

Phenotype CV: 

General

Experiment Batch ID: 

C

Experiment Contact: 

Start Date: 

14 August, 2012 - 09:00

End Date: 

24 September, 2012 - 09:00
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

LsCopB2
Fragment description

Fragment length: 

566bp

Fragment concentration: 

600ng/ul

Sense sequence: 

atcgtgtcaagtccacagacctgcacccagtggagccttggatgttggcctcgctctacaacgggaacgtgcacatttggaactacgagtctcagcagttggtcaagtccctggaggtgtgcgacttgccggtgcgagccgccaagtttgtgagccgtaagaattgggtggtgacgggttctgacgacatgaagctgaatgtgttcaactacaacaccctggagcgtgtgtcttgcctggaggcgcactctgactatctgcggtccctggccgtccacccgagtgagcccctggtcctctcctcctcggacgacatgctcattaagctctggaactgggacaaggcctgggcctgtgaacaggtcttcgagggacacacgcactacataatgcaagtggtcatcaaccccaaggacaacaacacttttgcctccgcctctttggaccgcaccatcaaggtctggcacttgggcgcatcttgccccaacttcactctggagggacatgacaagggcgtcaactgtctggactactaccacgccggggacaagccctacctcatctcg

Fragment Label ID: 

F4

Primer Group: 

b671

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>82%
Phenotype

Number of Individuals (End): 

0
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of LsCopB2 in preadult female lice. Early termination after 15 days (Rack 4a and 4b - no survivors in 4c at normal termination date). High mortality, empty gut, no egg strings, underdeveloped genital segment and abdomen.

B F2+F3 (IRP1+IRP2)

Phenotype CV: 

General

Experiment Batch ID: 

B

Experiment Contact: 

Start Date: 

19 March, 2012 - 09:00

End Date: 

18 April, 2012 - 09:00
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description
Fragment description

Fragment length: 

441bp

Fragment concentration: 

600ng/ul

Sense sequence: 

ggtgtgagtccgagtccacagcgattccaattaaattaatgaaagaagggccctcatcagggactatggaagatgaagaccttctcaaggatttccaagttggggaaagaagctacaaatattacgacgtaacccaaatccagggctatgaggaactcccttactccttgcgtgttctcctggagtgtgccgttcgaaagcgttcggaaacgcaaggacaagtctggaaggatgtttatgaacggattttgaggcgagttcttcttcaggatttcacaggagttccagcattgatcgatttagcagcgatccgtgaatctgtatccaagtccggtggttgtccggatgtggtggacagtctttgtccagcagatctggttgtagatcactgtgttcaagtggactacaaccaaatcaagcagcaactgtcaagtccgcctg

Fragment Label ID: 

F3
F2

Fragment Mixture Formula: 

1:1 mixture, resulting in 300 ng/ul for each of the fragments

Primer Group: 

b640

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>44%
Phenotype

Number of Individuals (End): 

23
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of LsIRP1A+LsIRP1B (formerly called IRP1 and IRP2) in preadult female lice. Slightly shorter egg strings. Knockdown 62% for IRP1 and 44% for IRP2. Described in the fragment fields is only F3, see experiment A for F2.

A F4 (CopB2)

Phenotype CV: 

General

Experiment Batch ID: 

A

Experiment Contact: 

Start Date: 

23 January, 2012 - 09:00

End Date: 

24 February, 2012 - 09:00
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

LsCopB2
Fragment description

Fragment length: 

566bp

Fragment concentration: 

600ng/ul

Sense sequence: 

atcgtgtcaagtccacagacctgcacccagtggagccttggatgttggcctcgctctacaacgggaacgtgcacatttggaactacgagtctcagcagttggtcaagtccctggaggtgtgcgacttgccggtgcgagccgccaagtttgtgagccgtaagaattgggtggtgacgggttctgacgacatgaagctgaatgtgttcaactacaacaccctggagcgtgtgtcttgcctggaggcgcactctgactatctgcggtccctggccgtccacccgagtgagcccctggtcctctcctcctcggacgacatgctcattaagctctggaactgggacaaggcctgggcctgtgaacaggtcttcgagggacacacgcactacataatgcaagtggtcatcaaccccaaggacaacaacacttttgcctccgcctctttggaccgcaccatcaaggtctggcacttgggcgcatcttgccccaacttcactctggagggacatgacaagggcgtcaactgtctggactactaccacgccggggacaagccctacctcatctcg

Fragment Label ID: 

F4

Primer Group: 

b671

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>65%
Phenotype

Number of Individuals (End): 

5
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of LsCopB2 in preadult female lice. High mortality, empty gut, no egg strings, underdeveloped genital segment and abdomen.

A F3 (IRP2)

Phenotype CV: 

General

Experiment Batch ID: 

A

Experiment Contact: 

Start Date: 

23 January, 2012 - 09:00

End Date: 

24 February, 2012 - 09:00
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

LsIRP1B
Fragment description

Fragment length: 

441bp

Fragment concentration: 

600ng/ul

Sense sequence: 

ggtgtgagtccgagtccacagcgattccaattaaattaatgaaagaagggccctcatcagggactatggaagatgaagaccttctcaaggatttccaagttggggaaagaagctacaaatattacgacgtaacccaaatccagggctatgaggaactcccttactccttgcgtgttctcctggagtgtgccgttcgaaagcgttcggaaacgcaaggacaagtctggaaggatgtttatgaacggattttgaggcgagttcttcttcaggatttcacaggagttccagcattgatcgatttagcagcgatccgtgaatctgtatccaagtccggtggttgtccggatgtggtggacagtctttgtccagcagatctggttgtagatcactgtgttcaagtggactacaaccaaatcaagcagcaactgtcaagtccgcctg

Fragment Label ID: 

F3

Primer Group: 

b640

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>45%
Phenotype

Number of Individuals (End): 

23
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of LsIRP1B (formerly called IRP2) in preadult female lice. Slightly shorter egg strings caused less offspring.

D F32/F33

Phenotype CV: 

General

Experiment Batch ID: 

d

Experiment Contact: 

Start Date: 

24 August, 2012 - 13:49

End Date: 

3 October, 2012 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

40

Developmental Stage CV: 

PreAdult2
Target description
Fragment description

Fragment concentration: 

600ng/ul

Fragment Label ID: 

F

Primer Group: 

LS_TSC2-F_b872

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>30%
Phenotype

Number of Individuals (End): 

14
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Downreulation of TSC mix

D F33

Phenotype CV: 

General

Experiment Batch ID: 

d

Experiment Contact: 

Start Date: 

24 August, 2012 - 13:49

End Date: 

3 October, 2012 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

40

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

g18363_TSC2
Fragment description

Fragment length: 

432bp

Fragment concentration: 

600ng/ul

Sense sequence: 

aaaatgggcattcagcgacttggttgattggcacaatgcttataactgtttctacgagctgttgtacccatattgcaatgagaaatggtgtatgtgatagatgttatttttattgcattcgagatggaactttaagtaaggatgatattactaaaaattcggatagaagaagacacatgtcggatttttactccggtacaaataagagtcagttatcaaacttaagaagtgataaggaacttcataggcacacttctctggagagaatggagtcttctggagatgattatagagtaaaaaaagtgctacctgaaacatgcagttgttggtgctctggctgggctgaaatttacattcggcgtccaagtggggatgtatcctggatgtgtagagtgcaaaatactcagttgcttagtgcgcatacaccctcaa

Fragment Label ID: 

F33

Primer Group: 

LS_TSC2-F_b872

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>72%
Phenotype

Number of Individuals (End): 

11
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of 2599

D F31

Phenotype CV: 

General

Experiment Batch ID: 

d

Experiment Contact: 

Start Date: 

24 August, 2012 - 13:31

End Date: 

3 October, 2012 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

40

Developmental Stage CV: 

PreAdult2
Target description
Fragment description

Fragment length: 

505bp

Fragment concentration: 

600ng/ul

Sense sequence: 

tgtctggggactcagcctccaagatgggaggtatcctggccatagttgctctactcaacgcggatgtttgtaacacggggagtcgaattcatcgatttggaaattatcttcaaaacaattgtttaccgggagggaactccgtgacggatcctgtggtgattgccctggctactaaagccattggccgacttactcaagtatatggtagctacaaggctaatttacgctccgacttcattaattcactcgtcaagaaatcatttgagtggctttccaaccccaatgatcgcaatgatctcaagtggtacgctgctgttctcattctaagagaaatagccatttgtgagcccactttctttttccagaacgtaccaacgttttttgatcttatcttcattcctgtcagagactcaaaaccatttcttagagaatcagccgttaatgcgctacgagctggtctcatcgttactgcccaaagagaaaccaccaaacaatccagacgcca

Fragment Label ID: 

F31

Primer Group: 

LsTOR_f_b807
Validation

Efficacy of Knock Down: 

F>0%
Phenotype

Number of Individuals (End): 

14
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Downregulation of TOR

Pages

Subscribe to RSS - female reproduction